Mutagenetix > Incidental Mutations

Incidental Mutation 'R0614:Lrwd1'

54938

Institutional Source

Beutler Lab

Gene Symbol

Lrwd1

Ensembl Gene

ENSMUSG00000029703

Gene Name

leucine-rich repeats and WD repeat domain containing 1

Synonyms

1200011O22Rik, Orca

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.836) question?

Stock #

R0614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136122772-136136074 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136123500 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 570 (V570A)

Ref Sequence

ENSEMBL: ENSMUSP00000006301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041366] [ENSMUST00000111127] [ENSMUST00000111129]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006301
AA Change: V570A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: V570A

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
LRR_TYP	46	69	3.16e-3	SMART
LRR	90	113	1.58e2	SMART
WD40	271	327	6.36e1	SMART
Blast:WD40	330	380	2e-12	BLAST
WD40	383	423	1.49e-7	SMART
WD40	434	473	2.28e2	SMART
Blast:WD40	484	527	6e-15	BLAST
WD40	542	583	1.42e2	SMART
low complexity region	591	602	N/A	INTRINSIC
Blast:WD40	603	646	8e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000041366

SMART Domains

Protein: ENSMUSP00000038505
Gene: ENSMUSG00000039771

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_L_2	30	104	5.3e-32	PFAM
Pfam:RNA_pol_L	32	98	4.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111127

SMART Domains

Protein: ENSMUSP00000106757
Gene: ENSMUSG00000039771

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_L_2	29	105	3.6e-33	PFAM
Pfam:RNA_pol_L	31	99	1.8e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111129

SMART Domains

Protein: ENSMUSP00000106759
Gene: ENSMUSG00000039771

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_L	17	69	2.7e-9	PFAM
Pfam:RNA_pol_L_2	17	75	1.8e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128255

SMART Domains

Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

Domain	Start	End	E-Value	Type
Blast:WD40	13	66	2e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132976

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142272

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199799

Meta Mutation Damage Score

0.5889

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Lrwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01593:Lrwd1	APN	5	136134629	missense	probably damaging	1.00
IGL01827:Lrwd1	APN	5	136131518	nonsense	probably null
IGL01919:Lrwd1	APN	5	136135875	nonsense	probably null
IGL02327:Lrwd1	APN	5	136123464	missense	probably damaging	1.00
R0882:Lrwd1	UTSW	5	136123400	splice site	probably null
R1137:Lrwd1	UTSW	5	136133419	missense	probably benign	0.01
R1164:Lrwd1	UTSW	5	136130990	missense	probably benign	0.00
R1302:Lrwd1	UTSW	5	136132413	missense	probably benign	0.05
R1838:Lrwd1	UTSW	5	136132388	missense	probably benign	0.00
R2114:Lrwd1	UTSW	5	136130478	missense	probably damaging	1.00
R2116:Lrwd1	UTSW	5	136130478	missense	probably damaging	1.00
R2117:Lrwd1	UTSW	5	136130478	missense	probably damaging	1.00
R4514:Lrwd1	UTSW	5	136131548	missense	probably benign	0.00
R4595:Lrwd1	UTSW	5	136123956	missense	probably benign
R5304:Lrwd1	UTSW	5	136131150	missense	possibly damaging	0.49
R5384:Lrwd1	UTSW	5	136123874	missense	possibly damaging	0.84
R5719:Lrwd1	UTSW	5	136132239	splice site	probably null
R5771:Lrwd1	UTSW	5	136123662	missense	possibly damaging	0.95
R5791:Lrwd1	UTSW	5	136131033	missense	probably benign	0.44
R6431:Lrwd1	UTSW	5	136133034	missense	possibly damaging	0.90
R7074:Lrwd1	UTSW	5	136123657	missense	probably benign	0.01
R7132:Lrwd1	UTSW	5	136123275	missense	possibly damaging	0.71
R7838:Lrwd1	UTSW	5	136132129	missense	probably damaging	1.00
R7873:Lrwd1	UTSW	5	136123938	missense	probably benign	0.00
R7921:Lrwd1	UTSW	5	136132129	missense	probably damaging	1.00
R7956:Lrwd1	UTSW	5	136123938	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTACAAAGCCCTCTCCCATTAGC -3'
(R):5'- AGTCTGTGTTGCCCGTAGTCATCC -3'

Sequencing Primer
(F):5'- TTGTGCAGGCAGACTAGCATC -3'
(R):5'- TAGTCATCCTGGTCCGGC -3'

Posted On

2013-07-11