Mutagenetix > Incidental Mutations

Incidental Mutation 'R7078:Ptk2'

549381

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7078 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73221809 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 854 (P854S)

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,410,709	N210S	probably benign	Het
Acaca	G	A	11: 84,263,312	R953Q	possibly damaging	Het
Aldh1a1	A	T	19: 20,602,070	H20L	probably benign	Het
Ankrd52	T	A	10: 128,383,657	C487S	probably benign	Het
Ap1s3	T	C	1: 79,625,128	E54G	probably benign	Het
Arglu1	A	C	8: 8,667,361	M236R	probably benign	Het
Baz1b	T	A	5: 135,217,439	F581I	probably benign	Het
Bbox1	T	G	2: 110,292,539	D135A	probably benign	Het
Bcl2l14	T	A	6: 134,423,823	V69E	probably damaging	Het
Brinp3	C	T	1: 146,514,889	Q58*	probably null	Het
Ccnb1ip1	T	A	14: 50,792,267	K113*	probably null	Het
Cep128	T	C	12: 91,234,104	I830M	probably damaging	Het
Ces2f	C	T	8: 104,954,652	T541I	probably damaging	Het
Chsy3	C	A	18: 59,176,077	P134Q	possibly damaging	Het
Cobl	T	G	11: 12,378,271	T112P	probably damaging	Het
Dcc	T	A	18: 71,547,398	K589I	probably benign	Het
Depdc1b	T	A	13: 108,386,971	I460K	possibly damaging	Het
Dlst	T	C	12: 85,110,931	F12S	probably benign	Het
Dnah1	G	C	14: 31,297,110	F1342L	probably damaging	Het
Dtnb	A	G	12: 3,748,480	Q438R	possibly damaging	Het
Dusp4	C	A	8: 34,807,911	S61R	probably damaging	Het
E130308A19Rik	A	G	4: 59,737,688	Y433C	probably damaging	Het
Ebf2	T	C	14: 67,423,958	S512P	probably benign	Het
Eya1	C	T	1: 14,231,412		probably null	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fzr1	T	A	10: 81,368,629	D379V	probably damaging	Het
Gk2	T	A	5: 97,456,336	E214D	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gmnc	A	T	16: 26,960,522	V251E	probably benign	Het
Golga3	A	G	5: 110,193,087	Q549R	probably damaging	Het
Gsdmd	T	G	15: 75,864,355	V111G	probably damaging	Het
Gtf3c1	T	C	7: 125,645,742	T1707A	possibly damaging	Het
Gucy2c	C	T	6: 136,697,939	V1049M	probably benign	Het
Gucy2g	A	G	19: 55,241,151	V29A	probably damaging	Het
Hecw1	A	T	13: 14,434,459	M1K	probably null	Het
Hmcn1	T	C	1: 150,860,367	D117G	probably damaging	Het
Ifnab	T	A	4: 88,691,113	T39S	possibly damaging	Het
Lcorl	A	G	5: 45,747,224	Y171H	probably damaging	Het
Ly6g6c	C	T	17: 35,069,461	P103L	probably damaging	Het
Macf1	T	G	4: 123,432,143	E5189A	probably damaging	Het
Mapkap1	A	G	2: 34,563,139	E348G	probably damaging	Het
Med25	G	T	7: 44,884,901	A280D	probably damaging	Het
Mep1b	C	A	18: 21,100,051	A703E	probably benign	Het
Morn5	T	A	2: 36,054,978	N71K	probably benign	Het
Mtmr10	T	A	7: 64,320,627	Y373N	possibly damaging	Het
Myo1d	C	T	11: 80,674,634	E426K	probably damaging	Het
Ncbp1	G	C	4: 46,155,756	V302L	probably benign	Het
Notch4	A	G	17: 34,582,546	T1123A	possibly damaging	Het
Nudt18	T	A	14: 70,579,012	M88K	possibly damaging	Het
Olfr1452-ps1	A	T	19: 13,016,733	D170V	possibly damaging	Het
Olfr212	T	A	6: 116,516,671	L298Q	probably damaging	Het
Olfr361	A	G	2: 37,085,596	S51P	possibly damaging	Het
Olfr967	A	T	9: 39,750,491	Y35F	possibly damaging	Het
Pdcd6ip	T	C	9: 113,659,885	N694S	probably benign	Het
Pecam1	T	A	11: 106,688,947	T430S	probably benign	Het
Plaa	T	G	4: 94,574,051	T530P	probably benign	Het
Ppfia3	G	T	7: 45,360,595	Q95K	probably damaging	Het
Ppp4r2	T	C	6: 100,866,313	S331P	probably benign	Het
Prg4	T	C	1: 150,458,263	T117A	possibly damaging	Het
Prrc2b	A	T	2: 32,213,519	D1003V	probably benign	Het
Rasef	T	C	4: 73,780,389	I12V	probably benign	Het
Robo2	T	G	16: 74,352,616	Y108S	probably damaging	Het
Rp1	T	A	1: 4,206,791	E762V	unknown	Het
Rsg1	A	T	4: 141,219,848	Y180F	probably benign	Het
Rsrc1	T	C	3: 66,994,654	S46P	unknown	Het
Rttn	A	T	18: 89,009,422	T554S	probably benign	Het
Sall3	C	T	18: 80,974,099	V205M	probably damaging	Het
Scn3a	C	A	2: 65,497,600	V849L	probably damaging	Het
Sec23a	A	G	12: 58,992,283	C277R	probably benign	Het
Sf3b3	C	T	8: 110,813,007	A1075T	possibly damaging	Het
Sfxn5	T	C	6: 85,332,384	D113G	unknown	Het
Slc22a22	C	T	15: 57,263,480	M64I	probably benign	Het
Slc5a11	C	T	7: 123,258,446	P253S	probably damaging	Het
Smarcd3	A	G	5: 24,593,069	F449S	probably damaging	Het
Sspo	C	T	6: 48,460,379	T1357M	probably damaging	Het
Styx	C	T	14: 45,372,416	T179I	probably benign	Het
Syt7	A	T	19: 10,435,599	T297S	probably benign	Het
Tbx19	T	A	1: 165,160,566		probably benign	Het
Tg	T	A	15: 66,673,543	V149E	probably damaging	Het
Tgfbr3l	T	A	8: 4,249,238	L35Q	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem219	T	A	7: 126,891,803	T161S	probably damaging	Het
Tox2	T	A	2: 163,320,581	L68H		Het
Trim5	T	A	7: 104,278,474	D153V	possibly damaging	Het
Ttn	T	C	2: 76,750,307	Y23414C	probably damaging	Het
Ttn	A	T	2: 76,751,809	N22913K	probably damaging	Het
Ubr2	A	C	17: 46,955,853	M1124R	possibly damaging	Het
Vmn2r75	A	G	7: 86,166,360	S99P	probably damaging	Het
Wdr83	T	C	8: 85,076,051	D219G	probably damaging	Het
Wdr90	C	T	17: 25,849,649	V1285M	probably damaging	Het
Zmynd15	A	T	11: 70,460,755	L62F	probably damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGTGATCTGCATCTATGAAAATCTGG -3'
(R):5'- ACTTGGGAGCAGTGTCACAG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'

Posted On

2019-05-15