Incidental Mutation 'R7079:Olfr1188'
ID549404
Institutional Source Beutler Lab
Gene Symbol Olfr1188
Ensembl Gene ENSMUSG00000068809
Gene Nameolfactory receptor 1188
SynonymsMOR238-2, GA_x6K02T2Q125-50046879-50047784
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88556935-88560815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88559509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000150850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090701] [ENSMUST00000217131]
Predicted Effect probably damaging
Transcript: ENSMUST00000090701
AA Change: N13K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088202
Gene: ENSMUSG00000068809
AA Change: N13K

DomainStartEndE-ValueType
Pfam:7tm_4 36 309 5.9e-49 PFAM
Pfam:7tm_1 46 292 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217131
AA Change: N2K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Olfr1188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Olfr1188 APN 2 88560065 missense probably benign 0.02
R1525:Olfr1188 UTSW 2 88559641 missense probably damaging 1.00
R1530:Olfr1188 UTSW 2 88559483 missense probably benign 0.23
R1703:Olfr1188 UTSW 2 88560255 missense possibly damaging 0.56
R1750:Olfr1188 UTSW 2 88560058 missense possibly damaging 0.94
R4626:Olfr1188 UTSW 2 88559832 missense possibly damaging 0.69
R4645:Olfr1188 UTSW 2 88560378 missense probably damaging 0.98
R4934:Olfr1188 UTSW 2 88559586 missense probably benign 0.00
R5643:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R5644:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R6539:Olfr1188 UTSW 2 88559520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCATTTCCCTTTGGTATGGC -3'
(R):5'- GCATCTTAGGGATTGTGCAAGAG -3'

Sequencing Primer
(F):5'- CCCTTTGGTATGGCATGAAAC -3'
(R):5'- TTGTGCAAGAGGAATAACATGCATC -3'
Posted On2019-05-15