Incidental Mutation 'R7079:4921509C19Rik'
ID 549405
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene Name RIKEN cDNA 4921509C19 gene
Synonyms LOC381389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7079 (G1)
Quality Score 100.008
Status Not validated
Chromosome 2
Chromosomal Location 151470542-151476153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 151473278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 160 (D160A)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080132
AA Change: D160A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: D160A

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151473533 missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151473546 missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151472561 missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151473485 missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151472700 missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151472766 missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151472057 missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151472904 missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R4206:4921509C19Rik UTSW 2 151473515 missense probably benign 0.44
R4655:4921509C19Rik UTSW 2 151472858 missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151473470 missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151471871 missense unknown
R4702:4921509C19Rik UTSW 2 151472589 missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151472822 nonsense probably null
R4962:4921509C19Rik UTSW 2 151472808 missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151472540 missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151471931 missense probably benign
R5602:4921509C19Rik UTSW 2 151473539 missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151472880 missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151473307 missense probably damaging 1.00
R7109:4921509C19Rik UTSW 2 151473753 missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151473569 missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151472925 missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R7853:4921509C19Rik UTSW 2 151473680 missense probably damaging 1.00
R8773:4921509C19Rik UTSW 2 151472142 missense possibly damaging 0.91
R8805:4921509C19Rik UTSW 2 151471365 splice site probably benign
R8983:4921509C19Rik UTSW 2 151471352 missense unknown
R9257:4921509C19Rik UTSW 2 151473707 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGTACTTTCCTGCAATGATCTTC -3'
(R):5'- TTCATCGTTCTGGAGCATGC -3'

Sequencing Primer
(F):5'- GCTATATCCATTGAAAGGAAGGCACC -3'
(R):5'- CATGCTGTGGGAGGAGAGCTG -3'
Posted On 2019-05-15