Incidental Mutation 'R7079:Ubqln3'
ID549416
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104141371 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 504 (I504K)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: I504K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I504K

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCGGGGATCCTCAGACATAAC -3'
(R):5'- CCAGTACTAGCTTGCCCAATC -3'

Sequencing Primer
(F):5'- AACAACACCTTCTCTAGCTTCTGTG -3'
(R):5'- CTTACCTCTCAGATAGGAGATTCTG -3'
Posted On2019-05-15