Incidental Mutation 'R7079:Cyp1a2'
ID549419
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 2
SynonymsCP12, aromatic compound inducible, P450-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57676937-57683703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57681878 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 218 (I218V)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
Predicted Effect probably benign
Transcript: ENSMUST00000034860
AA Change: I218V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: I218V

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57682069 nonsense probably null
IGL01161:Cyp1a2 APN 9 57679893 missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57682372 missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57682202 missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57682395 missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57677228 makesense probably null
IGL03349:Cyp1a2 APN 9 57679875 missense possibly damaging 0.82
broadway UTSW 9 57677233 nonsense probably null
PIT4515001:Cyp1a2 UTSW 9 57681959 missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57682061 missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57682025 missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57680246 splice site probably benign
R0589:Cyp1a2 UTSW 9 57679062 missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57681767 missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57682286 missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57682150 missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57677515 missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57679949 missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57681868 missense probably benign
R5225:Cyp1a2 UTSW 9 57677233 nonsense probably null
R5419:Cyp1a2 UTSW 9 57682511 missense probably benign 0.17
R5471:Cyp1a2 UTSW 9 57679020 missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57681053 missense probably benign
R6017:Cyp1a2 UTSW 9 57681030 missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57677260 missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57682156 missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57677242 missense probably damaging 0.99
R7081:Cyp1a2 UTSW 9 57678989 missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57681940 missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57682337 missense probably benign 0.05
R8097:Cyp1a2 UTSW 9 57679553 splice site probably null
RF007:Cyp1a2 UTSW 9 57681970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTCACCTTGTTGAAGTCTTG -3'
(R):5'- AGAGCTTCTCCATAGCCTCG -3'

Sequencing Primer
(F):5'- AAGTCTTGGTAGTGCTCCTGGAC -3'
(R):5'- CCTCTTGCTATTTGGAGGAGCAC -3'
Posted On2019-05-15