Incidental Mutation 'R7079:Slc26a6'
ID549420
Institutional Source Beutler Lab
Gene Symbol Slc26a6
Ensembl Gene ENSMUSG00000023259
Gene Namesolute carrier family 26, member 6
SynonymsPat1, B930010B04Rik, CFEX
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108853283-108913049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108857948 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 348 (H348Q)
Ref Sequence ENSEMBL: ENSMUSP00000141336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000098376] [ENSMUST00000188557] [ENSMUST00000192507] [ENSMUST00000192559] [ENSMUST00000193291] [ENSMUST00000193874]
Predicted Effect probably benign
Transcript: ENSMUST00000024238
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098376
AA Change: H348Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259
AA Change: H348Q

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188557
AA Change: H348Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140849
Gene: ENSMUSG00000023259
AA Change: H348Q

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192507
AA Change: H348Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259
AA Change: H348Q

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192559
SMART Domains Protein: ENSMUSP00000141632
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193291
AA Change: H348Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142250
Gene: ENSMUSG00000023259
AA Change: H348Q

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193874
SMART Domains Protein: ENSMUSP00000141409
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display abnormal proximal tubule and duodenal anion exchange, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Slc26a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Slc26a6 APN 9 108855889 missense probably benign
IGL02447:Slc26a6 APN 9 108857052 missense probably benign 0.03
IGL03090:Slc26a6 APN 9 108860691 missense probably benign 0.06
R0018:Slc26a6 UTSW 9 108858922 splice site probably null
R0083:Slc26a6 UTSW 9 108859113 splice site probably null
R0133:Slc26a6 UTSW 9 108861323 missense possibly damaging 0.86
R0135:Slc26a6 UTSW 9 108860595 splice site probably benign
R0563:Slc26a6 UTSW 9 108857670 missense probably damaging 1.00
R0661:Slc26a6 UTSW 9 108859113 splice site probably null
R1513:Slc26a6 UTSW 9 108855836 missense probably benign 0.41
R1746:Slc26a6 UTSW 9 108861717 missense probably benign 0.00
R2079:Slc26a6 UTSW 9 108859058 missense probably damaging 0.97
R2939:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R2940:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R3833:Slc26a6 UTSW 9 108855918 missense possibly damaging 0.86
R3861:Slc26a6 UTSW 9 108854196 unclassified probably benign
R4175:Slc26a6 UTSW 9 108854217 unclassified probably benign
R4358:Slc26a6 UTSW 9 108861783 missense probably benign 0.00
R4403:Slc26a6 UTSW 9 108855938 missense probably benign
R4598:Slc26a6 UTSW 9 108856380 missense probably damaging 1.00
R4660:Slc26a6 UTSW 9 108861341 missense probably damaging 0.96
R4663:Slc26a6 UTSW 9 108857907 missense probably damaging 0.98
R5296:Slc26a6 UTSW 9 108860646 missense probably damaging 1.00
R5390:Slc26a6 UTSW 9 108861300 splice site probably benign
R5533:Slc26a6 UTSW 9 108857956 missense probably damaging 1.00
R5662:Slc26a6 UTSW 9 108859339 missense possibly damaging 0.94
R5845:Slc26a6 UTSW 9 108862083 missense possibly damaging 0.46
R6547:Slc26a6 UTSW 9 108860782 intron probably null
R7652:Slc26a6 UTSW 9 108855944 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATAGCTAGAGTTGGGCCATCC -3'
(R):5'- TGTAAGAAGACTTGCTAGGGATGC -3'

Sequencing Primer
(F):5'- TAGAGTTGGGCCATCCTCTGAC -3'
(R):5'- GCTAGGGATGCTTATACTGACACAC -3'
Posted On2019-05-15