Incidental Mutation 'R7079:Fbxw21'
ID 549421
Institutional Source Beutler Lab
Gene Symbol Fbxw21
Ensembl Gene ENSMUSG00000047237
Gene Name F-box and WD-40 domain protein 21
Synonyms E330009P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7079 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 109139447-109162041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109145510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 314 (I314T)
Ref Sequence ENSEMBL: ENSMUSP00000143095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054925] [ENSMUST00000198076] [ENSMUST00000199540]
AlphaFold Q8BI38
Predicted Effect probably benign
Transcript: ENSMUST00000054925
AA Change: I314T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237
AA Change: I314T

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197401
Predicted Effect probably benign
Transcript: ENSMUST00000198076
AA Change: I314T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143095
Gene: ENSMUSG00000047237
AA Change: I314T

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 9e-8 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199540
SMART Domains Protein: ENSMUSP00000143200
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 9e-9 SMART
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Fbxw21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Fbxw21 APN 9 109161964 missense probably damaging 1.00
IGL00901:Fbxw21 APN 9 109156399 missense probably benign 0.00
IGL01377:Fbxw21 APN 9 109146645 nonsense probably null
IGL01941:Fbxw21 APN 9 109148156 missense probably benign 0.07
IGL02491:Fbxw21 APN 9 109143819 missense probably benign
IGL03163:Fbxw21 APN 9 109145484 missense probably benign 0.01
IGL03377:Fbxw21 APN 9 109139529 missense probably benign 0.01
R0148:Fbxw21 UTSW 9 109148017 critical splice donor site probably null
R0328:Fbxw21 UTSW 9 109146585 missense possibly damaging 0.52
R0909:Fbxw21 UTSW 9 109156408 missense possibly damaging 0.84
R1506:Fbxw21 UTSW 9 109148189 missense probably damaging 1.00
R1575:Fbxw21 UTSW 9 109161916 missense probably benign 0.00
R1615:Fbxw21 UTSW 9 109143726 missense probably damaging 1.00
R1719:Fbxw21 UTSW 9 109148174 missense possibly damaging 0.85
R2415:Fbxw21 UTSW 9 109156401 missense possibly damaging 0.71
R2424:Fbxw21 UTSW 9 109157519 nonsense probably null
R2508:Fbxw21 UTSW 9 109145485 missense probably benign 0.31
R2898:Fbxw21 UTSW 9 109156336 missense possibly damaging 0.52
R2964:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2965:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2966:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R4809:Fbxw21 UTSW 9 109143390 missense probably damaging 1.00
R4911:Fbxw21 UTSW 9 109145663 missense probably damaging 1.00
R5669:Fbxw21 UTSW 9 109145510 missense probably benign 0.12
R5928:Fbxw21 UTSW 9 109143825 missense possibly damaging 0.55
R6043:Fbxw21 UTSW 9 109145539 missense possibly damaging 0.69
R6277:Fbxw21 UTSW 9 109145555 missense possibly damaging 0.95
R6805:Fbxw21 UTSW 9 109157565 missense probably damaging 1.00
R6944:Fbxw21 UTSW 9 109157535 missense probably damaging 1.00
R7081:Fbxw21 UTSW 9 109161922 missense probably damaging 1.00
R7744:Fbxw21 UTSW 9 109157652 missense possibly damaging 0.81
R7774:Fbxw21 UTSW 9 109143840 missense probably benign 0.00
R7980:Fbxw21 UTSW 9 109156571 splice site probably null
R8043:Fbxw21 UTSW 9 109146626 missense probably benign 0.01
R8260:Fbxw21 UTSW 9 109146546 critical splice donor site probably null
R9142:Fbxw21 UTSW 9 109156345 missense probably damaging 1.00
R9172:Fbxw21 UTSW 9 109146696 missense probably benign 0.00
R9250:Fbxw21 UTSW 9 109143778 missense probably benign 0.31
R9251:Fbxw21 UTSW 9 109145619 missense probably damaging 1.00
R9294:Fbxw21 UTSW 9 109143762 missense probably damaging 0.99
R9303:Fbxw21 UTSW 9 109157659 missense probably benign
R9479:Fbxw21 UTSW 9 109139544 missense probably benign 0.00
R9509:Fbxw21 UTSW 9 109148149 missense possibly damaging 0.90
R9765:Fbxw21 UTSW 9 109146557 missense possibly damaging 0.71
R9773:Fbxw21 UTSW 9 109148060 missense possibly damaging 0.89
R9774:Fbxw21 UTSW 9 109161989 start codon destroyed probably null 0.98
Z1088:Fbxw21 UTSW 9 109145537 missense probably benign
Z1176:Fbxw21 UTSW 9 109145537 missense probably benign
Z1177:Fbxw21 UTSW 9 109145537 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGCACATGCTAAACCATC -3'
(R):5'- CAGGCTGCAGAGATTCACTC -3'

Sequencing Primer
(F):5'- GTGCACATGCTAAACCATCTTCTCAG -3'
(R):5'- CCTGGACAATTCTCTCTGCAGG -3'
Posted On 2019-05-15