Incidental Mutation 'R7079:Psme2b'
ID 549428
Institutional Source Beutler Lab
Gene Symbol Psme2b
Ensembl Gene ENSMUSG00000078153
Gene Name protease (prosome, macropain) activator subunit 2B
Synonyms Psme2-like, PA28b2, Psme2b, Psme2b-ps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R7079 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 48945354-48946190 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48945616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 168 (F168S)
Ref Sequence ENSEMBL: ENSMUSP00000100564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
AlphaFold P97372
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097494
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000104958
AA Change: F168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153
AA Change: F168S

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene may encode proteasome activator complex subunit 2 protein (PMID: 10222192). This gene, located on chromosome 11, lacks a structured promoter and is intronless. It has also been described as a pseudogene (PMID: 9914329), however, it has an intact coding region and transcripts can be placed at this location unambiguously. An interferon-inducible gene located on chromosome 14, near the gene that encodes proteasome activator complex subunit 1 protein, is considered the functional gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Psme2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Psme2b APN 11 48946119 utr 5 prime probably benign
IGL03309:Psme2b APN 11 48945799 splice site probably null
R0087:Psme2b UTSW 11 48945717 missense possibly damaging 0.95
R0523:Psme2b UTSW 11 48945782 missense probably damaging 0.97
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1502:Psme2b UTSW 11 48945749 missense probably damaging 1.00
R1540:Psme2b UTSW 11 48945382 splice site probably null
R1793:Psme2b UTSW 11 48945534 missense probably damaging 1.00
R1967:Psme2b UTSW 11 48946069 missense probably damaging 0.99
R2426:Psme2b UTSW 11 48946063 missense probably benign 0.20
R4667:Psme2b UTSW 11 48945666 missense probably benign 0.00
R5011:Psme2b UTSW 11 48945827 missense probably benign 0.00
R5013:Psme2b UTSW 11 48945827 missense probably benign 0.00
R6131:Psme2b UTSW 11 48945925 missense probably damaging 0.96
R6860:Psme2b UTSW 11 48945480 nonsense probably null
R7794:Psme2b UTSW 11 48945856 missense probably benign
R7888:Psme2b UTSW 11 48945575 missense possibly damaging 0.72
R9449:Psme2b UTSW 11 48945739 missense probably damaging 0.98
R9748:Psme2b UTSW 11 48945952 missense possibly damaging 0.95
RF020:Psme2b UTSW 11 48945570 missense probably damaging 0.97
X0025:Psme2b UTSW 11 48945886 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTCGGGTTGACGATTTTC -3'
(R):5'- AAGCTTCTGGCCTTGCTTG -3'

Sequencing Primer
(F):5'- ACGATTTTCTCTAGGTTGCTGC -3'
(R):5'- GCCTTGCTTGCTTTGGTTAAG -3'
Posted On 2019-05-15