Incidental Mutation 'R7079:Ptk2'
ID549437
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene NamePTK2 protein tyrosine kinase 2
SynonymsFRNK, FAK, Fadk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location73205102-73423280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73221809 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 854 (P854S)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Uhrf2 T G 19: 30,082,790 N519K probably null Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CAGTGATCTGCATCTATGAAAATCTGG -3'
(R):5'- TTGGGAGCAGTGTCACAGTG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'
Posted On2019-05-15