Incidental Mutation 'R7079:Uhrf2'
ID549445
Institutional Source Beutler Lab
Gene Symbol Uhrf2
Ensembl Gene ENSMUSG00000024817
Gene Nameubiquitin-like, containing PHD and RING finger domains 2
SynonymsNirf, D130071B19Rik, 2310065A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R7079 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location30030513-30093722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30082790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 519 (N519K)
Ref Sequence ENSEMBL: ENSMUSP00000025739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025739]
Predicted Effect probably null
Transcript: ENSMUST00000025739
AA Change: N519K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025739
Gene: ENSMUSG00000024817
AA Change: N519K

DomainStartEndE-ValueType
UBQ 1 74 8.95e-7 SMART
Pfam:TTD 125 313 2.2e-66 PFAM
PHD 347 394 9.54e-11 SMART
RING 348 393 1.38e0 SMART
SRA 444 617 2.82e-77 SMART
low complexity region 644 661 N/A INTRINSIC
RING 734 772 3.67e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is involved in cell-cycle regulation. The encoded protein is a ubiquitin-ligase capable of ubiquinating PCNP (PEST-containing nuclear protein), and together they may play a role in tumorigenesis. The encoded protein contains an NIRF_N domain, a PHD finger, a set- and ring-associated (SRA) domain, and a RING finger domain and several of these domains have been shown to be essential for the regulation of cell proliferation. This protein may also have a role in intranuclear degradation of polyglutamine aggregates. Alternative splicing results in multiple transcript variants some of which are non-protein coding. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous KO causes deregulated expression of neuron-related genes, reduced DNA methylation in the brain and impaired contextual conditioning and spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,254,204 L405S possibly damaging Het
2310009B15Rik T A 1: 138,852,127 Q129L possibly damaging Het
4921509C19Rik T G 2: 151,473,278 D160A probably damaging Het
9330182L06Rik A G 5: 9,399,253 Y127C probably damaging Het
Aspn A G 13: 49,566,555 Y349C probably damaging Het
Atp2b1 A G 10: 99,018,733 T1063A probably benign Het
BC035947 T C 1: 78,497,915 E660G probably damaging Het
Cadps2 A G 6: 23,323,409 L970P probably damaging Het
Caskin1 T C 17: 24,498,884 I215T probably benign Het
Cort C G 4: 149,127,391 G85R probably benign Het
Cyp1a2 T C 9: 57,681,878 I218V probably benign Het
Egfem1 T A 3: 29,153,582 H140Q probably benign Het
Fam205a1 T C 4: 42,851,718 E146G probably benign Het
Fbln5 G A 12: 101,757,408 P345S probably damaging Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Gfpt2 G A 11: 49,837,751 V679I possibly damaging Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Grm1 T C 10: 11,079,958 D194G probably damaging Het
Hectd1 G A 12: 51,787,855 T875M possibly damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hhat T C 1: 192,553,046 H434R possibly damaging Het
Itpripl2 A G 7: 118,490,869 F156L possibly damaging Het
Kctd11 A G 11: 69,880,021 Y64H probably damaging Het
Lmln T C 16: 33,067,291 L97P probably benign Het
Lrrc30 T C 17: 67,632,021 D188G possibly damaging Het
Mmd T A 11: 90,267,499 probably null Het
Nav3 G A 10: 109,767,292 S1132L probably benign Het
Olfr1188 C A 2: 88,559,509 N2K probably damaging Het
Olfr365 C A 2: 37,202,173 H311N probably benign Het
Olfr598 C T 7: 103,329,184 R233C probably benign Het
Pcdh15 A G 10: 74,317,125 T421A probably benign Het
Pfkm G A 15: 98,095,082 R7H probably benign Het
Psme2b A G 11: 48,945,616 F168S probably damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn13 T C 5: 103,501,886 V385A probably benign Het
Reep5 G A 18: 34,347,123 T189I probably damaging Het
Sacm1l T A 9: 123,569,997 Y272N probably damaging Het
Slc26a6 T A 9: 108,857,948 H348Q probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stkld1 A G 2: 26,949,347 I342V probably benign Het
Trim23 A T 13: 104,187,293 probably null Het
Trmt13 T C 3: 116,582,831 T304A probably benign Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Ubqln3 A T 7: 104,141,371 I504K probably benign Het
Wdr93 T C 7: 79,749,292 M58T probably damaging Het
Wwc2 G A 8: 47,847,545 T961M unknown Het
Zfp35 C T 18: 24,003,300 H234Y possibly damaging Het
Zscan21 C T 5: 138,126,466 P215S probably benign Het
Other mutations in Uhrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Uhrf2 APN 19 30073946 missense probably benign 0.03
IGL01290:Uhrf2 APN 19 30039301 splice site probably benign
IGL01599:Uhrf2 APN 19 30092120 missense probably damaging 1.00
IGL01724:Uhrf2 APN 19 30075252 missense probably benign 0.29
IGL01861:Uhrf2 APN 19 30086404 missense probably damaging 1.00
IGL02182:Uhrf2 APN 19 30039209 missense probably benign
IGL02673:Uhrf2 APN 19 30092807 missense probably damaging 1.00
R0502:Uhrf2 UTSW 19 30092776 missense probably damaging 1.00
R1136:Uhrf2 UTSW 19 30056226 splice site probably benign
R1510:Uhrf2 UTSW 19 30039061 splice site probably benign
R2110:Uhrf2 UTSW 19 30056488 missense probably damaging 1.00
R3760:Uhrf2 UTSW 19 30073931 missense probably benign 0.20
R3951:Uhrf2 UTSW 19 30079861 missense probably damaging 1.00
R3967:Uhrf2 UTSW 19 30079915 missense probably damaging 1.00
R3970:Uhrf2 UTSW 19 30079915 missense probably damaging 1.00
R5129:Uhrf2 UTSW 19 30075221 missense probably benign 0.00
R5568:Uhrf2 UTSW 19 30039088 missense probably damaging 1.00
R5875:Uhrf2 UTSW 19 30089302 missense probably damaging 1.00
R7053:Uhrf2 UTSW 19 30092119 missense probably damaging 1.00
R7298:Uhrf2 UTSW 19 30088549 missense probably benign
R7382:Uhrf2 UTSW 19 30071388 missense possibly damaging 0.90
R7575:Uhrf2 UTSW 19 30071368 missense probably damaging 1.00
R7730:Uhrf2 UTSW 19 30075101 missense probably damaging 1.00
X0020:Uhrf2 UTSW 19 30089345 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACACTTGGTCATGTTTTGC -3'
(R):5'- GGGGATTATGCTACTTAAACGTG -3'

Sequencing Primer
(F):5'- GCTTTATTTTGGCAAATTCTCTGAG -3'
(R):5'- GGATTATGCTACTTAAACGTGAACAG -3'
Posted On2019-05-15