Incidental Mutation 'R7080:Gpr19'
ID549462
Institutional Source Beutler Lab
Gene Symbol Gpr19
Ensembl Gene ENSMUSG00000032641
Gene NameG protein-coupled receptor 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134869093-134898578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134870456 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 88 (V88D)
Ref Sequence ENSEMBL: ENSMUSP00000066287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046255] [ENSMUST00000066107] [ENSMUST00000111932] [ENSMUST00000116515] [ENSMUST00000165392] [ENSMUST00000203409] [ENSMUST00000203762] [ENSMUST00000204880] [ENSMUST00000215088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046255
AA Change: V2D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047630
Gene: ENSMUSG00000032641
AA Change: V2D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 1.8e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066107
AA Change: V88D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066287
Gene: ENSMUSG00000032641
AA Change: V88D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 76 345 1.7e-12 PFAM
Pfam:7tm_1 82 330 5.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111932
SMART Domains Protein: ENSMUSP00000107563
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116515
SMART Domains Protein: ENSMUSP00000112214
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165392
SMART Domains Protein: ENSMUSP00000127876
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 339 2.6e-12 PFAM
Pfam:7tm_1 76 324 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203409
SMART Domains Protein: ENSMUSP00000145128
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 70 132 9e-5 PFAM
Pfam:7tm_1 76 135 2.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203762
Predicted Effect probably benign
Transcript: ENSMUST00000204880
SMART Domains Protein: ENSMUSP00000144918
Gene: ENSMUSG00000032641

DomainStartEndE-ValueType
transmembrane domain 59 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215088
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased anxiety-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdc42bpg T C 19: 6,315,189 V692A probably damaging Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr215 A T 6: 116,582,353 F198I probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Olfr975 A G 9: 39,950,148 C208R probably damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Ranbp1 T C 16: 18,245,233 D93G possibly damaging Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Slc2a12 T C 10: 22,665,317 V357A probably benign Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Gpr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpr19 APN 6 134869742 missense probably damaging 0.99
IGL01373:Gpr19 APN 6 134870321 missense possibly damaging 0.81
IGL01988:Gpr19 APN 6 134869284 missense probably damaging 1.00
R1530:Gpr19 UTSW 6 134869998 missense probably damaging 0.97
R1548:Gpr19 UTSW 6 134870084 missense possibly damaging 0.92
R1699:Gpr19 UTSW 6 134870229 missense possibly damaging 0.93
R2131:Gpr19 UTSW 6 134870442 start codon destroyed probably null 0.99
R5016:Gpr19 UTSW 6 134869917 nonsense probably null
R6605:Gpr19 UTSW 6 134870435 missense probably benign 0.02
R7746:Gpr19 UTSW 6 134869392 missense probably damaging 1.00
R8014:Gpr19 UTSW 6 134869473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGCTCTGTCCTGTTGC -3'
(R):5'- TTGCTGGGAGGAGACAGATTC -3'

Sequencing Primer
(F):5'- GAAGCTCTGTCCTGTTGCTCATC -3'
(R):5'- CTCGGTGAATGAGAATGGCTC -3'
Posted On2019-05-15