Incidental Mutation 'R7080:Ranbp1'
ID549486
Institutional Source Beutler Lab
Gene Symbol Ranbp1
Ensembl Gene ENSMUSG00000005732
Gene NameRAN binding protein 1
SynonymsHtf9a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18239784-18248732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18245233 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 93 (D93G)
Ref Sequence ENSEMBL: ENSMUSP00000111309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052325
AA Change: D43G

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732
AA Change: D43G

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115645
AA Change: D93G

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732
AA Change: D93G

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Meta Mutation Damage Score 0.8957 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, decreased body weight, impaired spermatogenesis, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdc42bpg T C 19: 6,315,189 V692A probably damaging Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Gpr19 A T 6: 134,870,456 V88D probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr215 A T 6: 116,582,353 F198I probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Olfr975 A G 9: 39,950,148 C208R probably damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Slc2a12 T C 10: 22,665,317 V357A probably benign Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Ranbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Ranbp1 APN 16 18247281 unclassified probably benign
R0189:Ranbp1 UTSW 16 18241743 critical splice donor site probably null
R0764:Ranbp1 UTSW 16 18240158 nonsense probably null
R3276:Ranbp1 UTSW 16 18247429 unclassified probably benign
R4381:Ranbp1 UTSW 16 18247344 missense probably damaging 1.00
R4620:Ranbp1 UTSW 16 18240104 unclassified probably benign
R5127:Ranbp1 UTSW 16 18247287 critical splice donor site probably null
R5655:Ranbp1 UTSW 16 18241805 missense probably damaging 1.00
R5965:Ranbp1 UTSW 16 18245228 missense probably damaging 0.97
R7900:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
R8356:Ranbp1 UTSW 16 18245306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACAGCCTAAATTCACTG -3'
(R):5'- GCAATTGGTCCAGGTGTGAG -3'

Sequencing Primer
(F):5'- TCACTGTCATAGTTCAGAGACTTG -3'
(R):5'- GAACACTTTGTGGCAATTAGTCCAGG -3'
Posted On2019-05-15