Incidental Mutation 'R7080:Cdc42bpg'
ID549491
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6315189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 692 (V692A)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: V692A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: V692A

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Gpr19 A T 6: 134,870,456 V88D probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr215 A T 6: 116,582,353 F198I probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Olfr975 A G 9: 39,950,148 C208R probably damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Ranbp1 T C 16: 18,245,233 D93G possibly damaging Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Slc2a12 T C 10: 22,665,317 V357A probably benign Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R8186:Cdc42bpg UTSW 19 6306865 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGGAACTGGAGCTAC -3'
(R):5'- AGCATAAACCTGGAGCCTTG -3'

Sequencing Primer
(F):5'- TCAGCTGGTAGGGACAT -3'
(R):5'- ACTTGAGGTCAATCTCTGGGAACC -3'
Posted On2019-05-15