Incidental Mutation 'R7081:Krit1'
ID549513
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene NameKRIT1, ankyrin repeat containing
SynonymsKrit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7081 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3803184-3845564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3823651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 477 (Y477H)
Ref Sequence ENSEMBL: ENSMUSP00000078985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000200386] [ENSMUST00000200577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080085
AA Change: Y477H

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: Y477H

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171023
AA Change: Y477H

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600
AA Change: Y477H

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200386
AA Change: Y429H

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600
AA Change: Y429H

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,817 V82A possibly damaging Het
Aatf T A 11: 84,471,125 H337L possibly damaging Het
Abcb4 T A 5: 8,934,263 N664K probably benign Het
Adh7 A G 3: 138,228,845 D343G probably benign Het
Als2cl G A 9: 110,894,582 R682Q possibly damaging Het
Angptl6 A C 9: 20,875,348 I334R probably damaging Het
Ankrd45 A G 1: 161,151,293 N101D probably benign Het
Arhgef10 C T 8: 14,997,547 Q1137* probably null Het
Asap3 T A 4: 136,241,570 probably null Het
Bmp2k T C 5: 97,064,961 S568P unknown Het
C4b A C 17: 34,735,443 F917L probably benign Het
Cacna1e A T 1: 154,700,383 V168E possibly damaging Het
Ccdc60 T A 5: 116,126,087 I543F probably benign Het
Cd36 T C 5: 17,814,704 D133G probably damaging Het
Chd4 T C 6: 125,129,985 V1911A unknown Het
Cplx4 A T 18: 65,967,467 probably null Het
Cyp1a2 A T 9: 57,678,989 D415E possibly damaging Het
Cyp3a57 T C 5: 145,381,373 I388T probably damaging Het
Dnajc5b T C 3: 19,546,861 probably null Het
Dock4 A T 12: 40,621,286 I35F probably damaging Het
Efna4 A T 3: 89,334,294 L206Q unknown Het
Eif2a T C 3: 58,541,718 probably null Het
Fam120a A G 13: 48,910,325 F612L probably damaging Het
Fbxw21 A G 9: 109,161,922 L23P probably damaging Het
Fcamr A T 1: 130,813,212 E456V probably damaging Het
Fkbp8 G A 8: 70,530,994 R106H probably benign Het
Galr2 T A 11: 116,283,048 L168Q probably damaging Het
Gm11111 C T 5: 98,553,540 S22L unknown Het
Gm14124 A G 2: 150,268,269 H293R possibly damaging Het
Gm3183 T A 5: 94,874,782 N107K possibly damaging Het
Gnpat T C 8: 124,863,269 F11S possibly damaging Het
H2-T24 A T 17: 36,017,452 D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Ifna12 T C 4: 88,603,203 R36G probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Kif5c T A 2: 49,741,361 D683E probably benign Het
Lipm T A 19: 34,121,323 V399D possibly damaging Het
Lrguk A T 6: 34,102,139 T770S probably benign Het
Lrrc37a T C 11: 103,457,955 N2638S unknown Het
Lrrc40 T C 3: 158,036,805 V27A probably damaging Het
Map4k1 T C 7: 28,991,149 V355A probably benign Het
Mylk3 T C 8: 85,364,793 I128V probably benign Het
Myo1c A G 11: 75,660,963 D289G probably benign Het
Mypn A G 10: 63,134,958 F889S probably damaging Het
Ndufv3 C T 17: 31,527,433 P99L possibly damaging Het
Nlrp10 A C 7: 108,924,648 S542A probably benign Het
Noc2l T A 4: 156,247,020 D718E possibly damaging Het
Ntng1 T A 3: 109,851,789 I355F probably benign Het
Nup210 A G 6: 91,060,665 V742A possibly damaging Het
Olfr1037 A T 2: 86,085,595 F61I probably damaging Het
Olfr560 A T 7: 102,753,188 I247N probably benign Het
Olig2 T A 16: 91,226,419 L7Q probably damaging Het
Parpbp A T 10: 88,093,655 W444R probably damaging Het
Plekhg3 A G 12: 76,578,245 E1287G probably benign Het
Pramef25 T C 4: 143,949,278 D326G probably damaging Het
Prrc2b A T 2: 32,213,063 Q851L probably benign Het
Psg21 C T 7: 18,654,849 W106* probably null Het
Rab18 T G 18: 6,778,529 D53E probably benign Het
Rbm19 T A 5: 120,123,151 probably null Het
Rhobtb1 T C 10: 69,266,297 V136A probably benign Het
Rsph4a G A 10: 33,909,193 V367I probably damaging Het
Sec24b T C 3: 129,987,742 N1161S probably benign Het
Sgcd C A 11: 47,125,601 G145* probably null Het
Sin3a A G 9: 57,094,471 K134R probably null Het
Slc9b2 A G 3: 135,321,937 E108G probably benign Het
Stk24 A T 14: 121,294,294 S317T probably benign Het
Stra8 T A 6: 34,934,367 probably null Het
Tmem131 A G 1: 36,889,295 V71A possibly damaging Het
Tmem87a T C 2: 120,380,783 D227G possibly damaging Het
Vnn1 T A 10: 23,895,005 L44M possibly damaging Het
Wdr20 G A 12: 110,803,450 V160I possibly damaging Het
Zfand4 T A 6: 116,315,620 N667K possibly damaging Het
Zfp609 A G 9: 65,702,441 V1080A possibly damaging Het
Zhx1 C T 15: 58,054,338 V171I probably benign Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3812844 missense probably damaging 0.98
IGL02186:Krit1 APN 5 3809733 splice site probably benign
IGL02526:Krit1 APN 5 3822103 missense probably damaging 1.00
IGL03280:Krit1 APN 5 3811248 splice site probably benign
IGL03385:Krit1 APN 5 3807452 missense possibly damaging 0.51
Waspish UTSW 5 3831551 missense probably damaging 1.00
R0127:Krit1 UTSW 5 3822178 missense probably damaging 0.99
R0594:Krit1 UTSW 5 3823694 missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3832176 missense probably damaging 1.00
R1777:Krit1 UTSW 5 3836799 missense probably damaging 0.96
R2115:Krit1 UTSW 5 3822108 nonsense probably null
R4021:Krit1 UTSW 5 3832132 missense probably benign 0.21
R4041:Krit1 UTSW 5 3809642 missense probably damaging 1.00
R4786:Krit1 UTSW 5 3812467 missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3822238 missense probably damaging 1.00
R5217:Krit1 UTSW 5 3806451 nonsense probably null
R5304:Krit1 UTSW 5 3819326 missense probably damaging 0.99
R5371:Krit1 UTSW 5 3831551 missense probably damaging 1.00
R5682:Krit1 UTSW 5 3830737 missense probably damaging 0.99
R6248:Krit1 UTSW 5 3813032 splice site probably null
R6338:Krit1 UTSW 5 3836857 missense probably benign 0.01
R7454:Krit1 UTSW 5 3812474 missense probably damaging 0.99
R7497:Krit1 UTSW 5 3812349 missense possibly damaging 0.93
R7684:Krit1 UTSW 5 3830723 missense possibly damaging 0.75
R7780:Krit1 UTSW 5 3812772 missense probably damaging 1.00
R7862:Krit1 UTSW 5 3812788 missense probably damaging 0.99
R8041:Krit1 UTSW 5 3807309 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAGCTCCCAAGAAATGCTCG -3'
(R):5'- CCTACAGATCCTGTGGATTCAAATAAC -3'

Sequencing Primer
(F):5'- CTTTAATCCTAGCACTCGGGAGG -3'
(R):5'- GGAAGTCCCACATCTCTT -3'
Posted On2019-05-15