Incidental Mutation 'R7081:Lrguk'
ID 549522
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 045175-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34079074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 770 (T770S)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228187
AA Change: T770S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T A 11: 84,361,951 (GRCm39) H337L possibly damaging Het
Abcb4 T A 5: 8,984,263 (GRCm39) N664K probably benign Het
Adh7 A G 3: 137,934,606 (GRCm39) D343G probably benign Het
Als2cl G A 9: 110,723,650 (GRCm39) R682Q possibly damaging Het
Angptl6 A C 9: 20,786,644 (GRCm39) I334R probably damaging Het
Ankrd45 A G 1: 160,978,863 (GRCm39) N101D probably benign Het
Arhgef10 C T 8: 15,047,547 (GRCm39) Q1137* probably null Het
Asap3 T A 4: 135,968,881 (GRCm39) probably null Het
Bmp2k T C 5: 97,212,820 (GRCm39) S568P unknown Het
C4b A C 17: 34,954,417 (GRCm39) F917L probably benign Het
Cacna1e A T 1: 154,576,129 (GRCm39) V168E possibly damaging Het
Ccdc60 T A 5: 116,264,146 (GRCm39) I543F probably benign Het
Cd36 T C 5: 18,019,702 (GRCm39) D133G probably damaging Het
Chd4 T C 6: 125,106,948 (GRCm39) V1911A unknown Het
Cplx4 A T 18: 66,100,538 (GRCm39) probably null Het
Cyp1a2 A T 9: 57,586,272 (GRCm39) D415E possibly damaging Het
Cyp3a57 T C 5: 145,318,183 (GRCm39) I388T probably damaging Het
Dnajc5b T C 3: 19,601,025 (GRCm39) probably null Het
Dock4 A T 12: 40,671,285 (GRCm39) I35F probably damaging Het
Efna4 A T 3: 89,241,601 (GRCm39) L206Q unknown Het
Eif2a T C 3: 58,449,139 (GRCm39) probably null Het
Fam120a A G 13: 49,063,801 (GRCm39) F612L probably damaging Het
Fbxw21 A G 9: 108,990,990 (GRCm39) L23P probably damaging Het
Fcamr A T 1: 130,740,949 (GRCm39) E456V probably damaging Het
Fkbp8 G A 8: 70,983,644 (GRCm39) R106H probably benign Het
Galr2 T A 11: 116,173,874 (GRCm39) L168Q probably damaging Het
Gm11111 C T 5: 98,701,399 (GRCm39) S22L unknown Het
Gnpat T C 8: 125,590,008 (GRCm39) F11S possibly damaging Het
H2-T24 A T 17: 36,328,344 (GRCm39) D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Ifna12 T C 4: 88,521,440 (GRCm39) R36G probably damaging Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Kif5c T A 2: 49,631,373 (GRCm39) D683E probably benign Het
Krit1 T C 5: 3,873,651 (GRCm39) Y477H possibly damaging Het
Lipm T A 19: 34,098,723 (GRCm39) V399D possibly damaging Het
Lrrc37a T C 11: 103,348,781 (GRCm39) N2638S unknown Het
Lrrc40 T C 3: 157,742,442 (GRCm39) V27A probably damaging Het
Map4k1 T C 7: 28,690,574 (GRCm39) V355A probably benign Het
Mylk3 T C 8: 86,091,422 (GRCm39) I128V probably benign Het
Myo1c A G 11: 75,551,789 (GRCm39) D289G probably benign Het
Mypn A G 10: 62,970,737 (GRCm39) F889S probably damaging Het
Ndufv3 C T 17: 31,746,407 (GRCm39) P99L possibly damaging Het
Nlrp10 A C 7: 108,523,855 (GRCm39) S542A probably benign Het
Noc2l T A 4: 156,331,477 (GRCm39) D718E possibly damaging Het
Ntng1 T A 3: 109,759,105 (GRCm39) I355F probably benign Het
Nup210 A G 6: 91,037,647 (GRCm39) V742A possibly damaging Het
Nup50l A G 6: 96,142,798 (GRCm39) V82A possibly damaging Het
Olig2 T A 16: 91,023,307 (GRCm39) L7Q probably damaging Het
Or51f23b A T 7: 102,402,395 (GRCm39) I247N probably benign Het
Or8u10 A T 2: 85,915,939 (GRCm39) F61I probably damaging Het
Parpbp A T 10: 87,929,517 (GRCm39) W444R probably damaging Het
Plekhg3 A G 12: 76,625,019 (GRCm39) E1287G probably benign Het
Pramel16 T C 4: 143,675,848 (GRCm39) D326G probably damaging Het
Pramel56 T A 5: 95,022,641 (GRCm39) N107K possibly damaging Het
Prrc2b A T 2: 32,103,075 (GRCm39) Q851L probably benign Het
Psg21 C T 7: 18,388,774 (GRCm39) W106* probably null Het
Rab18 T G 18: 6,778,529 (GRCm39) D53E probably benign Het
Rbm19 T A 5: 120,261,216 (GRCm39) probably null Het
Rhobtb1 T C 10: 69,102,127 (GRCm39) V136A probably benign Het
Rsph4a G A 10: 33,785,189 (GRCm39) V367I probably damaging Het
Sec24b T C 3: 129,781,391 (GRCm39) N1161S probably benign Het
Sgcd C A 11: 47,016,428 (GRCm39) G145* probably null Het
Sin3a A G 9: 57,001,755 (GRCm39) K134R probably null Het
Slc9b2 A G 3: 135,027,698 (GRCm39) E108G probably benign Het
Stk24 A T 14: 121,531,706 (GRCm39) S317T probably benign Het
Stra8 T A 6: 34,911,302 (GRCm39) probably null Het
Tmem131 A G 1: 36,928,376 (GRCm39) V71A possibly damaging Het
Tmem87a T C 2: 120,211,264 (GRCm39) D227G possibly damaging Het
Vnn1 T A 10: 23,770,903 (GRCm39) L44M possibly damaging Het
Wdr20 G A 12: 110,769,884 (GRCm39) V160I possibly damaging Het
Zfand4 T A 6: 116,292,581 (GRCm39) N667K possibly damaging Het
Zfp1005 A G 2: 150,110,189 (GRCm39) H293R possibly damaging Het
Zfp609 A G 9: 65,609,723 (GRCm39) V1080A possibly damaging Het
Zhx1 C T 15: 57,917,734 (GRCm39) V171I probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCACTTGGTATTCCTCAGCAG -3'
(R):5'- TCTCTGAGGACTGAGGGAAG -3'

Sequencing Primer
(F):5'- TATTCCTCAGCAGGCCCAG -3'
(R):5'- TCTCTGAGGACTGAGGGAAGCTAAG -3'
Posted On 2019-05-15