Incidental Mutation 'R7081:Lrguk'
ID 549522
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34102139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 770 (T770S)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228187
AA Change: T770S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,817 V82A possibly damaging Het
Aatf T A 11: 84,471,125 H337L possibly damaging Het
Abcb4 T A 5: 8,934,263 N664K probably benign Het
Adh7 A G 3: 138,228,845 D343G probably benign Het
Als2cl G A 9: 110,894,582 R682Q possibly damaging Het
Angptl6 A C 9: 20,875,348 I334R probably damaging Het
Ankrd45 A G 1: 161,151,293 N101D probably benign Het
Arhgef10 C T 8: 14,997,547 Q1137* probably null Het
Asap3 T A 4: 136,241,570 probably null Het
Bmp2k T C 5: 97,064,961 S568P unknown Het
C4b A C 17: 34,735,443 F917L probably benign Het
Cacna1e A T 1: 154,700,383 V168E possibly damaging Het
Ccdc60 T A 5: 116,126,087 I543F probably benign Het
Cd36 T C 5: 17,814,704 D133G probably damaging Het
Chd4 T C 6: 125,129,985 V1911A unknown Het
Cplx4 A T 18: 65,967,467 probably null Het
Cyp1a2 A T 9: 57,678,989 D415E possibly damaging Het
Cyp3a57 T C 5: 145,381,373 I388T probably damaging Het
Dnajc5b T C 3: 19,546,861 probably null Het
Dock4 A T 12: 40,621,286 I35F probably damaging Het
Efna4 A T 3: 89,334,294 L206Q unknown Het
Eif2a T C 3: 58,541,718 probably null Het
Fam120a A G 13: 48,910,325 F612L probably damaging Het
Fbxw21 A G 9: 109,161,922 L23P probably damaging Het
Fcamr A T 1: 130,813,212 E456V probably damaging Het
Fkbp8 G A 8: 70,530,994 R106H probably benign Het
Galr2 T A 11: 116,283,048 L168Q probably damaging Het
Gm11111 C T 5: 98,553,540 S22L unknown Het
Gm14124 A G 2: 150,268,269 H293R possibly damaging Het
Gm3183 T A 5: 94,874,782 N107K possibly damaging Het
Gnpat T C 8: 124,863,269 F11S possibly damaging Het
H2-T24 A T 17: 36,017,452 D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Ifna12 T C 4: 88,603,203 R36G probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Kif5c T A 2: 49,741,361 D683E probably benign Het
Krit1 T C 5: 3,823,651 Y477H possibly damaging Het
Lipm T A 19: 34,121,323 V399D possibly damaging Het
Lrrc37a T C 11: 103,457,955 N2638S unknown Het
Lrrc40 T C 3: 158,036,805 V27A probably damaging Het
Map4k1 T C 7: 28,991,149 V355A probably benign Het
Mylk3 T C 8: 85,364,793 I128V probably benign Het
Myo1c A G 11: 75,660,963 D289G probably benign Het
Mypn A G 10: 63,134,958 F889S probably damaging Het
Ndufv3 C T 17: 31,527,433 P99L possibly damaging Het
Nlrp10 A C 7: 108,924,648 S542A probably benign Het
Noc2l T A 4: 156,247,020 D718E possibly damaging Het
Ntng1 T A 3: 109,851,789 I355F probably benign Het
Nup210 A G 6: 91,060,665 V742A possibly damaging Het
Olfr1037 A T 2: 86,085,595 F61I probably damaging Het
Olfr560 A T 7: 102,753,188 I247N probably benign Het
Olig2 T A 16: 91,226,419 L7Q probably damaging Het
Parpbp A T 10: 88,093,655 W444R probably damaging Het
Plekhg3 A G 12: 76,578,245 E1287G probably benign Het
Pramef25 T C 4: 143,949,278 D326G probably damaging Het
Prrc2b A T 2: 32,213,063 Q851L probably benign Het
Psg21 C T 7: 18,654,849 W106* probably null Het
Rab18 T G 18: 6,778,529 D53E probably benign Het
Rbm19 T A 5: 120,123,151 probably null Het
Rhobtb1 T C 10: 69,266,297 V136A probably benign Het
Rsph4a G A 10: 33,909,193 V367I probably damaging Het
Sec24b T C 3: 129,987,742 N1161S probably benign Het
Sgcd C A 11: 47,125,601 G145* probably null Het
Sin3a A G 9: 57,094,471 K134R probably null Het
Slc9b2 A G 3: 135,321,937 E108G probably benign Het
Stk24 A T 14: 121,294,294 S317T probably benign Het
Stra8 T A 6: 34,934,367 probably null Het
Tmem131 A G 1: 36,889,295 V71A possibly damaging Het
Tmem87a T C 2: 120,380,783 D227G possibly damaging Het
Vnn1 T A 10: 23,895,005 L44M possibly damaging Het
Wdr20 G A 12: 110,803,450 V160I possibly damaging Het
Zfand4 T A 6: 116,315,620 N667K possibly damaging Het
Zfp609 A G 9: 65,702,441 V1080A possibly damaging Het
Zhx1 C T 15: 58,054,338 V171I probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCACTTGGTATTCCTCAGCAG -3'
(R):5'- TCTCTGAGGACTGAGGGAAG -3'

Sequencing Primer
(F):5'- TATTCCTCAGCAGGCCCAG -3'
(R):5'- TCTCTGAGGACTGAGGGAAGCTAAG -3'
Posted On 2019-05-15