Incidental Mutation 'R7081:Idh2'
ID549530
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7081 (G1)
Quality Score115.467
Status Not validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GGTCCCAG to GG at 80098329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000107384
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,817 V82A possibly damaging Het
Aatf T A 11: 84,471,125 H337L possibly damaging Het
Abcb4 T A 5: 8,934,263 N664K probably benign Het
Adh7 A G 3: 138,228,845 D343G probably benign Het
Als2cl G A 9: 110,894,582 R682Q possibly damaging Het
Angptl6 A C 9: 20,875,348 I334R probably damaging Het
Ankrd45 A G 1: 161,151,293 N101D probably benign Het
Arhgef10 C T 8: 14,997,547 Q1137* probably null Het
Asap3 T A 4: 136,241,570 probably null Het
Bmp2k T C 5: 97,064,961 S568P unknown Het
C4b A C 17: 34,735,443 F917L probably benign Het
Cacna1e A T 1: 154,700,383 V168E possibly damaging Het
Ccdc60 T A 5: 116,126,087 I543F probably benign Het
Cd36 T C 5: 17,814,704 D133G probably damaging Het
Chd4 T C 6: 125,129,985 V1911A unknown Het
Cplx4 A T 18: 65,967,467 probably null Het
Cyp1a2 A T 9: 57,678,989 D415E possibly damaging Het
Cyp3a57 T C 5: 145,381,373 I388T probably damaging Het
Dnajc5b T C 3: 19,546,861 probably null Het
Dock4 A T 12: 40,621,286 I35F probably damaging Het
Efna4 A T 3: 89,334,294 L206Q unknown Het
Eif2a T C 3: 58,541,718 probably null Het
Fam120a A G 13: 48,910,325 F612L probably damaging Het
Fbxw21 A G 9: 109,161,922 L23P probably damaging Het
Fcamr A T 1: 130,813,212 E456V probably damaging Het
Fkbp8 G A 8: 70,530,994 R106H probably benign Het
Galr2 T A 11: 116,283,048 L168Q probably damaging Het
Gm11111 C T 5: 98,553,540 S22L unknown Het
Gm14124 A G 2: 150,268,269 H293R possibly damaging Het
Gm3183 T A 5: 94,874,782 N107K possibly damaging Het
Gnpat T C 8: 124,863,269 F11S possibly damaging Het
H2-T24 A T 17: 36,017,452 D46E probably damaging Het
Ifna12 T C 4: 88,603,203 R36G probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Kif5c T A 2: 49,741,361 D683E probably benign Het
Krit1 T C 5: 3,823,651 Y477H possibly damaging Het
Lipm T A 19: 34,121,323 V399D possibly damaging Het
Lrguk A T 6: 34,102,139 T770S probably benign Het
Lrrc37a T C 11: 103,457,955 N2638S unknown Het
Lrrc40 T C 3: 158,036,805 V27A probably damaging Het
Map4k1 T C 7: 28,991,149 V355A probably benign Het
Mylk3 T C 8: 85,364,793 I128V probably benign Het
Myo1c A G 11: 75,660,963 D289G probably benign Het
Mypn A G 10: 63,134,958 F889S probably damaging Het
Ndufv3 C T 17: 31,527,433 P99L possibly damaging Het
Nlrp10 A C 7: 108,924,648 S542A probably benign Het
Noc2l T A 4: 156,247,020 D718E possibly damaging Het
Ntng1 T A 3: 109,851,789 I355F probably benign Het
Nup210 A G 6: 91,060,665 V742A possibly damaging Het
Olfr1037 A T 2: 86,085,595 F61I probably damaging Het
Olfr560 A T 7: 102,753,188 I247N probably benign Het
Olig2 T A 16: 91,226,419 L7Q probably damaging Het
Parpbp A T 10: 88,093,655 W444R probably damaging Het
Plekhg3 A G 12: 76,578,245 E1287G probably benign Het
Pramef25 T C 4: 143,949,278 D326G probably damaging Het
Prrc2b A T 2: 32,213,063 Q851L probably benign Het
Psg21 C T 7: 18,654,849 W106* probably null Het
Rab18 T G 18: 6,778,529 D53E probably benign Het
Rbm19 T A 5: 120,123,151 probably null Het
Rhobtb1 T C 10: 69,266,297 V136A probably benign Het
Rsph4a G A 10: 33,909,193 V367I probably damaging Het
Sec24b T C 3: 129,987,742 N1161S probably benign Het
Sgcd C A 11: 47,125,601 G145* probably null Het
Sin3a A G 9: 57,094,471 K134R probably null Het
Slc9b2 A G 3: 135,321,937 E108G probably benign Het
Stk24 A T 14: 121,294,294 S317T probably benign Het
Stra8 T A 6: 34,934,367 probably null Het
Tmem131 A G 1: 36,889,295 V71A possibly damaging Het
Tmem87a T C 2: 120,380,783 D227G possibly damaging Het
Vnn1 T A 10: 23,895,005 L44M possibly damaging Het
Wdr20 G A 12: 110,803,450 V160I possibly damaging Het
Zfand4 T A 6: 116,315,620 N667K possibly damaging Het
Zfp609 A G 9: 65,702,441 V1080A possibly damaging Het
Zhx1 C T 15: 58,054,338 V171I probably benign Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 unclassified probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCATCAGAGGTTGTTACTTGTC -3'
(R):5'- AGTAGGCGGCTTAAACAAGC -3'

Sequencing Primer
(F):5'- GTCAAAGATCTCCTGGAAGATGTC -3'
(R):5'- GCCTGTACCAGCTATAAGGTCTAG -3'
Posted On2019-05-15