Incidental Mutation 'R7081:Nlrp10'
ID549532
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7081 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108924648 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 542 (S542A)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: S542A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: S542A

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,817 V82A possibly damaging Het
Aatf T A 11: 84,471,125 H337L possibly damaging Het
Abcb4 T A 5: 8,934,263 N664K probably benign Het
Adh7 A G 3: 138,228,845 D343G probably benign Het
Als2cl G A 9: 110,894,582 R682Q possibly damaging Het
Angptl6 A C 9: 20,875,348 I334R probably damaging Het
Ankrd45 A G 1: 161,151,293 N101D probably benign Het
Arhgef10 C T 8: 14,997,547 Q1137* probably null Het
Asap3 T A 4: 136,241,570 probably null Het
Bmp2k T C 5: 97,064,961 S568P unknown Het
C4b A C 17: 34,735,443 F917L probably benign Het
Cacna1e A T 1: 154,700,383 V168E possibly damaging Het
Ccdc60 T A 5: 116,126,087 I543F probably benign Het
Cd36 T C 5: 17,814,704 D133G probably damaging Het
Chd4 T C 6: 125,129,985 V1911A unknown Het
Cplx4 A T 18: 65,967,467 probably null Het
Cyp1a2 A T 9: 57,678,989 D415E possibly damaging Het
Cyp3a57 T C 5: 145,381,373 I388T probably damaging Het
Dnajc5b T C 3: 19,546,861 probably null Het
Dock4 A T 12: 40,621,286 I35F probably damaging Het
Efna4 A T 3: 89,334,294 L206Q unknown Het
Eif2a T C 3: 58,541,718 probably null Het
Fam120a A G 13: 48,910,325 F612L probably damaging Het
Fbxw21 A G 9: 109,161,922 L23P probably damaging Het
Fcamr A T 1: 130,813,212 E456V probably damaging Het
Fkbp8 G A 8: 70,530,994 R106H probably benign Het
Galr2 T A 11: 116,283,048 L168Q probably damaging Het
Gm11111 C T 5: 98,553,540 S22L unknown Het
Gm14124 A G 2: 150,268,269 H293R possibly damaging Het
Gm3183 T A 5: 94,874,782 N107K possibly damaging Het
Gnpat T C 8: 124,863,269 F11S possibly damaging Het
H2-T24 A T 17: 36,017,452 D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Ifna12 T C 4: 88,603,203 R36G probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Kif5c T A 2: 49,741,361 D683E probably benign Het
Krit1 T C 5: 3,823,651 Y477H possibly damaging Het
Lipm T A 19: 34,121,323 V399D possibly damaging Het
Lrguk A T 6: 34,102,139 T770S probably benign Het
Lrrc37a T C 11: 103,457,955 N2638S unknown Het
Lrrc40 T C 3: 158,036,805 V27A probably damaging Het
Map4k1 T C 7: 28,991,149 V355A probably benign Het
Mylk3 T C 8: 85,364,793 I128V probably benign Het
Myo1c A G 11: 75,660,963 D289G probably benign Het
Mypn A G 10: 63,134,958 F889S probably damaging Het
Ndufv3 C T 17: 31,527,433 P99L possibly damaging Het
Noc2l T A 4: 156,247,020 D718E possibly damaging Het
Ntng1 T A 3: 109,851,789 I355F probably benign Het
Nup210 A G 6: 91,060,665 V742A possibly damaging Het
Olfr1037 A T 2: 86,085,595 F61I probably damaging Het
Olfr560 A T 7: 102,753,188 I247N probably benign Het
Olig2 T A 16: 91,226,419 L7Q probably damaging Het
Parpbp A T 10: 88,093,655 W444R probably damaging Het
Plekhg3 A G 12: 76,578,245 E1287G probably benign Het
Pramef25 T C 4: 143,949,278 D326G probably damaging Het
Prrc2b A T 2: 32,213,063 Q851L probably benign Het
Psg21 C T 7: 18,654,849 W106* probably null Het
Rab18 T G 18: 6,778,529 D53E probably benign Het
Rbm19 T A 5: 120,123,151 probably null Het
Rhobtb1 T C 10: 69,266,297 V136A probably benign Het
Rsph4a G A 10: 33,909,193 V367I probably damaging Het
Sec24b T C 3: 129,987,742 N1161S probably benign Het
Sgcd C A 11: 47,125,601 G145* probably null Het
Sin3a A G 9: 57,094,471 K134R probably null Het
Slc9b2 A G 3: 135,321,937 E108G probably benign Het
Stk24 A T 14: 121,294,294 S317T probably benign Het
Stra8 T A 6: 34,934,367 probably null Het
Tmem131 A G 1: 36,889,295 V71A possibly damaging Het
Tmem87a T C 2: 120,380,783 D227G possibly damaging Het
Vnn1 T A 10: 23,895,005 L44M possibly damaging Het
Wdr20 G A 12: 110,803,450 V160I possibly damaging Het
Zfand4 T A 6: 116,315,620 N667K possibly damaging Het
Zfp609 A G 9: 65,702,441 V1080A possibly damaging Het
Zhx1 C T 15: 58,054,338 V171I probably benign Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7397:Nlrp10 UTSW 7 108924692 missense probably damaging 1.00
R7720:Nlrp10 UTSW 7 108924488 missense probably benign 0.36
R7763:Nlrp10 UTSW 7 108925826 missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108925449 missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108925074 missense probably damaging 1.00
R8272:Nlrp10 UTSW 7 108925896 missense probably benign 0.00
Z1177:Nlrp10 UTSW 7 108925851 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGACTTTGTACCTTCCCG -3'
(R):5'- CTTGTGAAGGAGGACCAGAGTC -3'

Sequencing Primer
(F):5'- GACTTTGTACCTTCCCGCTACTAAAG -3'
(R):5'- TGGCAAAGCTGGTGGATCC -3'
Posted On2019-05-15