Mutagenetix > Incidental Mutations

Incidental Mutation 'R7081:Sin3a'

549538

Institutional Source

Beutler Lab

Gene Symbol

Sin3a

Ensembl Gene

ENSMUSG00000042557

Gene Name

transcriptional regulator, SIN3A (yeast)

Synonyms

Sin3, mSin3A

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7081 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57072040-57128366 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57094471 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 134 (K134R)

Ref Sequence

ENSEMBL: ENSMUSP00000130221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678] [ENSMUST00000169879]

Predicted Effect

probably null
Transcript: ENSMUST00000049169
AA Change: K134R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: K134R

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163400
AA Change: K75R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557
AA Change: K75R

Domain	Start	End	E-Value	Type
Pfam:PAH	82	128	2.1e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167715
AA Change: K134R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: K134R

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168177
AA Change: K134R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: K134R

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	142	186	5.3e-22	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	323	380	9.6e-22	PFAM
Pfam:PAH	479	523	8.1e-11	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
Pfam:Sin3a_C	887	1190	1.2e-93	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168502
AA Change: K134R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: K134R

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1138	1154	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168678
AA Change: K134R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: K134R

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169879

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,817	V82A	possibly damaging	Het
Aatf	T	A	11: 84,471,125	H337L	possibly damaging	Het
Abcb4	T	A	5: 8,934,263	N664K	probably benign	Het
Adh7	A	G	3: 138,228,845	D343G	probably benign	Het
Als2cl	G	A	9: 110,894,582	R682Q	possibly damaging	Het
Angptl6	A	C	9: 20,875,348	I334R	probably damaging	Het
Ankrd45	A	G	1: 161,151,293	N101D	probably benign	Het
Arhgef10	C	T	8: 14,997,547	Q1137*	probably null	Het
Asap3	T	A	4: 136,241,570		probably null	Het
Bmp2k	T	C	5: 97,064,961	S568P	unknown	Het
C4b	A	C	17: 34,735,443	F917L	probably benign	Het
Cacna1e	A	T	1: 154,700,383	V168E	possibly damaging	Het
Ccdc60	T	A	5: 116,126,087	I543F	probably benign	Het
Cd36	T	C	5: 17,814,704	D133G	probably damaging	Het
Chd4	T	C	6: 125,129,985	V1911A	unknown	Het
Cplx4	A	T	18: 65,967,467		probably null	Het
Cyp1a2	A	T	9: 57,678,989	D415E	possibly damaging	Het
Cyp3a57	T	C	5: 145,381,373	I388T	probably damaging	Het
Dnajc5b	T	C	3: 19,546,861		probably null	Het
Dock4	A	T	12: 40,621,286	I35F	probably damaging	Het
Efna4	A	T	3: 89,334,294	L206Q	unknown	Het
Eif2a	T	C	3: 58,541,718		probably null	Het
Fam120a	A	G	13: 48,910,325	F612L	probably damaging	Het
Fbxw21	A	G	9: 109,161,922	L23P	probably damaging	Het
Fcamr	A	T	1: 130,813,212	E456V	probably damaging	Het
Fkbp8	G	A	8: 70,530,994	R106H	probably benign	Het
Galr2	T	A	11: 116,283,048	L168Q	probably damaging	Het
Gm11111	C	T	5: 98,553,540	S22L	unknown	Het
Gm14124	A	G	2: 150,268,269	H293R	possibly damaging	Het
Gm3183	T	A	5: 94,874,782	N107K	possibly damaging	Het
Gnpat	T	C	8: 124,863,269	F11S	possibly damaging	Het
H2-T24	A	T	17: 36,017,452	D46E	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Ifna12	T	C	4: 88,603,203	R36G	probably damaging	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Kif5c	T	A	2: 49,741,361	D683E	probably benign	Het
Krit1	T	C	5: 3,823,651	Y477H	possibly damaging	Het
Lipm	T	A	19: 34,121,323	V399D	possibly damaging	Het
Lrguk	A	T	6: 34,102,139	T770S	probably benign	Het
Lrrc37a	T	C	11: 103,457,955	N2638S	unknown	Het
Lrrc40	T	C	3: 158,036,805	V27A	probably damaging	Het
Map4k1	T	C	7: 28,991,149	V355A	probably benign	Het
Mylk3	T	C	8: 85,364,793	I128V	probably benign	Het
Myo1c	A	G	11: 75,660,963	D289G	probably benign	Het
Mypn	A	G	10: 63,134,958	F889S	probably damaging	Het
Ndufv3	C	T	17: 31,527,433	P99L	possibly damaging	Het
Nlrp10	A	C	7: 108,924,648	S542A	probably benign	Het
Noc2l	T	A	4: 156,247,020	D718E	possibly damaging	Het
Ntng1	T	A	3: 109,851,789	I355F	probably benign	Het
Nup210	A	G	6: 91,060,665	V742A	possibly damaging	Het
Olfr1037	A	T	2: 86,085,595	F61I	probably damaging	Het
Olfr560	A	T	7: 102,753,188	I247N	probably benign	Het
Olig2	T	A	16: 91,226,419	L7Q	probably damaging	Het
Parpbp	A	T	10: 88,093,655	W444R	probably damaging	Het
Plekhg3	A	G	12: 76,578,245	E1287G	probably benign	Het
Pramef25	T	C	4: 143,949,278	D326G	probably damaging	Het
Prrc2b	A	T	2: 32,213,063	Q851L	probably benign	Het
Psg21	C	T	7: 18,654,849	W106*	probably null	Het
Rab18	T	G	18: 6,778,529	D53E	probably benign	Het
Rbm19	T	A	5: 120,123,151		probably null	Het
Rhobtb1	T	C	10: 69,266,297	V136A	probably benign	Het
Rsph4a	G	A	10: 33,909,193	V367I	probably damaging	Het
Sec24b	T	C	3: 129,987,742	N1161S	probably benign	Het
Sgcd	C	A	11: 47,125,601	G145*	probably null	Het
Slc9b2	A	G	3: 135,321,937	E108G	probably benign	Het
Stk24	A	T	14: 121,294,294	S317T	probably benign	Het
Stra8	T	A	6: 34,934,367		probably null	Het
Tmem131	A	G	1: 36,889,295	V71A	possibly damaging	Het
Tmem87a	T	C	2: 120,380,783	D227G	possibly damaging	Het
Vnn1	T	A	10: 23,895,005	L44M	possibly damaging	Het
Wdr20	G	A	12: 110,803,450	V160I	possibly damaging	Het
Zfand4	T	A	6: 116,315,620	N667K	possibly damaging	Het
Zfp609	A	G	9: 65,702,441	V1080A	possibly damaging	Het
Zhx1	C	T	15: 58,054,338	V171I	probably benign	Het

Other mutations in Sin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Sin3a	APN	9	57097901	missense	probably damaging	1.00
IGL00836:Sin3a	APN	9	57107345	splice site	probably null
IGL00913:Sin3a	APN	9	57098118	missense	probably benign	0.01
IGL01721:Sin3a	APN	9	57095325	missense	probably damaging	1.00
IGL01964:Sin3a	APN	9	57107347	splice site	probably benign
IGL02333:Sin3a	APN	9	57107559	missense	possibly damaging	0.86
IGL02673:Sin3a	APN	9	57107441	missense	probably damaging	0.99
Crumbled	UTSW	9	57110654	nonsense	probably null
Delicate	UTSW	9	57103929	missense	probably damaging	1.00
IGL03014:Sin3a	UTSW	9	57095255	intron	probably benign
PIT4519001:Sin3a	UTSW	9	57095456	missense	possibly damaging	0.86
R0024:Sin3a	UTSW	9	57118253	intron	probably benign
R0309:Sin3a	UTSW	9	57110912	missense	probably benign	0.00
R0511:Sin3a	UTSW	9	57096895	nonsense	probably null
R1205:Sin3a	UTSW	9	57119175	missense	probably damaging	1.00
R1365:Sin3a	UTSW	9	57125203	nonsense	probably null
R1496:Sin3a	UTSW	9	57119158	missense	possibly damaging	0.77
R1544:Sin3a	UTSW	9	57103997	splice site	probably benign
R1958:Sin3a	UTSW	9	57105609	missense	probably damaging	1.00
R1993:Sin3a	UTSW	9	57101199	missense	probably damaging	1.00
R2037:Sin3a	UTSW	9	57096825	missense	probably benign	0.14
R2065:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R2079:Sin3a	UTSW	9	57089523	missense	probably benign
R2193:Sin3a	UTSW	9	57117477	missense	possibly damaging	0.93
R3004:Sin3a	UTSW	9	57096834	nonsense	probably null
R3929:Sin3a	UTSW	9	57118137	missense	probably damaging	0.98
R4326:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4327:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4329:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4765:Sin3a	UTSW	9	57096803	missense	probably benign	0.14
R4806:Sin3a	UTSW	9	57086742	missense	probably damaging	0.99
R4979:Sin3a	UTSW	9	57118076	missense	probably damaging	1.00
R5018:Sin3a	UTSW	9	57110891	missense	probably benign	0.00
R5368:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R5379:Sin3a	UTSW	9	57110988	missense	probably benign	0.10
R5391:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5395:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5519:Sin3a	UTSW	9	57118173	critical splice donor site	probably null
R5927:Sin3a	UTSW	9	57111111	missense	probably damaging	1.00
R5987:Sin3a	UTSW	9	57127200	missense	possibly damaging	0.75
R6083:Sin3a	UTSW	9	57107540	missense	probably damaging	1.00
R6161:Sin3a	UTSW	9	57095424	missense	possibly damaging	0.48
R6196:Sin3a	UTSW	9	57103929	missense	probably damaging	1.00
R6374:Sin3a	UTSW	9	57117481	missense	probably benign
R6456:Sin3a	UTSW	9	57113701	missense	possibly damaging	0.79
R6815:Sin3a	UTSW	9	57117540	missense	probably benign	0.02
R6900:Sin3a	UTSW	9	57107574	missense	probably damaging	1.00
R7051:Sin3a	UTSW	9	57103934	missense	probably damaging	1.00
R7285:Sin3a	UTSW	9	57127299	missense	possibly damaging	0.57
R7462:Sin3a	UTSW	9	57095525	missense	probably benign	0.00
R7538:Sin3a	UTSW	9	57103926	missense	possibly damaging	0.95
R7699:Sin3a	UTSW	9	57110654	nonsense	probably null
R8150:Sin3a	UTSW	9	57127284	missense	possibly damaging	0.92
R8158:Sin3a	UTSW	9	57113544	critical splice acceptor site	probably null
RF017:Sin3a	UTSW	9	57127326	missense	possibly damaging	0.90
X0026:Sin3a	UTSW	9	57125192	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCTACAGATTTTATGAGTTGACC -3'
(R):5'- AGTGCTCTAGAATTACCATGAAACC -3'

Sequencing Primer
(F):5'- TGAGTTGACCTTTGTTTTAAAATTGC -3'
(R):5'- AACTCTTCAGGCTCAGGCTATAGG -3'

Posted On

2019-05-15