Mutagenetix > Incidental Mutations

Incidental Mutation 'R0614:Ptprk'

54956

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0614 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28075136 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 19 (P19L)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

Predicted Effect

unknown
Transcript: ENSMUST00000166468
AA Change: P19L

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: P19L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218276
AA Change: P19L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

unknown
Transcript: ENSMUST00000218359
AA Change: P19L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219478

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219761

Meta Mutation Damage Score

0.0820

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	unclassified	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACTCTGGACTACCCTGAGCAGC -3'
(R):5'- CCTCAGAAACAATGGGTCGAGAACG -3'

Sequencing Primer
(F):5'- TCTGCCTAGCATGGAGAGC -3'
(R):5'- TCGAGAACGTAAAAGTTACCTGC -3'

Posted On

2013-07-11