Incidental Mutation 'R7081:C4b'
ID 549562
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 045175-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34954417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 917 (F917L)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: F917L

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: F917L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T A 11: 84,361,951 (GRCm39) H337L possibly damaging Het
Abcb4 T A 5: 8,984,263 (GRCm39) N664K probably benign Het
Adh7 A G 3: 137,934,606 (GRCm39) D343G probably benign Het
Als2cl G A 9: 110,723,650 (GRCm39) R682Q possibly damaging Het
Angptl6 A C 9: 20,786,644 (GRCm39) I334R probably damaging Het
Ankrd45 A G 1: 160,978,863 (GRCm39) N101D probably benign Het
Arhgef10 C T 8: 15,047,547 (GRCm39) Q1137* probably null Het
Asap3 T A 4: 135,968,881 (GRCm39) probably null Het
Bmp2k T C 5: 97,212,820 (GRCm39) S568P unknown Het
Cacna1e A T 1: 154,576,129 (GRCm39) V168E possibly damaging Het
Ccdc60 T A 5: 116,264,146 (GRCm39) I543F probably benign Het
Cd36 T C 5: 18,019,702 (GRCm39) D133G probably damaging Het
Chd4 T C 6: 125,106,948 (GRCm39) V1911A unknown Het
Cplx4 A T 18: 66,100,538 (GRCm39) probably null Het
Cyp1a2 A T 9: 57,586,272 (GRCm39) D415E possibly damaging Het
Cyp3a57 T C 5: 145,318,183 (GRCm39) I388T probably damaging Het
Dnajc5b T C 3: 19,601,025 (GRCm39) probably null Het
Dock4 A T 12: 40,671,285 (GRCm39) I35F probably damaging Het
Efna4 A T 3: 89,241,601 (GRCm39) L206Q unknown Het
Eif2a T C 3: 58,449,139 (GRCm39) probably null Het
Fam120a A G 13: 49,063,801 (GRCm39) F612L probably damaging Het
Fbxw21 A G 9: 108,990,990 (GRCm39) L23P probably damaging Het
Fcamr A T 1: 130,740,949 (GRCm39) E456V probably damaging Het
Fkbp8 G A 8: 70,983,644 (GRCm39) R106H probably benign Het
Galr2 T A 11: 116,173,874 (GRCm39) L168Q probably damaging Het
Gm11111 C T 5: 98,701,399 (GRCm39) S22L unknown Het
Gnpat T C 8: 125,590,008 (GRCm39) F11S possibly damaging Het
H2-T24 A T 17: 36,328,344 (GRCm39) D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Ifna12 T C 4: 88,521,440 (GRCm39) R36G probably damaging Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Kif5c T A 2: 49,631,373 (GRCm39) D683E probably benign Het
Krit1 T C 5: 3,873,651 (GRCm39) Y477H possibly damaging Het
Lipm T A 19: 34,098,723 (GRCm39) V399D possibly damaging Het
Lrguk A T 6: 34,079,074 (GRCm39) T770S probably benign Het
Lrrc37a T C 11: 103,348,781 (GRCm39) N2638S unknown Het
Lrrc40 T C 3: 157,742,442 (GRCm39) V27A probably damaging Het
Map4k1 T C 7: 28,690,574 (GRCm39) V355A probably benign Het
Mylk3 T C 8: 86,091,422 (GRCm39) I128V probably benign Het
Myo1c A G 11: 75,551,789 (GRCm39) D289G probably benign Het
Mypn A G 10: 62,970,737 (GRCm39) F889S probably damaging Het
Ndufv3 C T 17: 31,746,407 (GRCm39) P99L possibly damaging Het
Nlrp10 A C 7: 108,523,855 (GRCm39) S542A probably benign Het
Noc2l T A 4: 156,331,477 (GRCm39) D718E possibly damaging Het
Ntng1 T A 3: 109,759,105 (GRCm39) I355F probably benign Het
Nup210 A G 6: 91,037,647 (GRCm39) V742A possibly damaging Het
Nup50l A G 6: 96,142,798 (GRCm39) V82A possibly damaging Het
Olig2 T A 16: 91,023,307 (GRCm39) L7Q probably damaging Het
Or51f23b A T 7: 102,402,395 (GRCm39) I247N probably benign Het
Or8u10 A T 2: 85,915,939 (GRCm39) F61I probably damaging Het
Parpbp A T 10: 87,929,517 (GRCm39) W444R probably damaging Het
Plekhg3 A G 12: 76,625,019 (GRCm39) E1287G probably benign Het
Pramel16 T C 4: 143,675,848 (GRCm39) D326G probably damaging Het
Pramel56 T A 5: 95,022,641 (GRCm39) N107K possibly damaging Het
Prrc2b A T 2: 32,103,075 (GRCm39) Q851L probably benign Het
Psg21 C T 7: 18,388,774 (GRCm39) W106* probably null Het
Rab18 T G 18: 6,778,529 (GRCm39) D53E probably benign Het
Rbm19 T A 5: 120,261,216 (GRCm39) probably null Het
Rhobtb1 T C 10: 69,102,127 (GRCm39) V136A probably benign Het
Rsph4a G A 10: 33,785,189 (GRCm39) V367I probably damaging Het
Sec24b T C 3: 129,781,391 (GRCm39) N1161S probably benign Het
Sgcd C A 11: 47,016,428 (GRCm39) G145* probably null Het
Sin3a A G 9: 57,001,755 (GRCm39) K134R probably null Het
Slc9b2 A G 3: 135,027,698 (GRCm39) E108G probably benign Het
Stk24 A T 14: 121,531,706 (GRCm39) S317T probably benign Het
Stra8 T A 6: 34,911,302 (GRCm39) probably null Het
Tmem131 A G 1: 36,928,376 (GRCm39) V71A possibly damaging Het
Tmem87a T C 2: 120,211,264 (GRCm39) D227G possibly damaging Het
Vnn1 T A 10: 23,770,903 (GRCm39) L44M possibly damaging Het
Wdr20 G A 12: 110,769,884 (GRCm39) V160I possibly damaging Het
Zfand4 T A 6: 116,292,581 (GRCm39) N667K possibly damaging Het
Zfp1005 A G 2: 150,110,189 (GRCm39) H293R possibly damaging Het
Zfp609 A G 9: 65,609,723 (GRCm39) V1080A possibly damaging Het
Zhx1 C T 15: 57,917,734 (GRCm39) V171I probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGACACAATTGAGTCACAATAG -3'
(R):5'- ATGTGGCTGTGAGACCGTAG -3'

Sequencing Primer
(F):5'- ACAATTGAGTCACAATAGTGGATTG -3'
(R):5'- AATTAGGAATCTCTGGCCATCC -3'
Posted On 2019-05-15