Mutagenetix > Incidental Mutation

Incidental Mutation 'R7081:C4b'

549562

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7081 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 34735443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 917 (F917L)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably benign
Transcript: ENSMUST00000069507
AA Change: F917L

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: F917L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,817	V82A	possibly damaging	Het
Aatf	T	A	11: 84,471,125	H337L	possibly damaging	Het
Abcb4	T	A	5: 8,934,263	N664K	probably benign	Het
Adh7	A	G	3: 138,228,845	D343G	probably benign	Het
Als2cl	G	A	9: 110,894,582	R682Q	possibly damaging	Het
Angptl6	A	C	9: 20,875,348	I334R	probably damaging	Het
Ankrd45	A	G	1: 161,151,293	N101D	probably benign	Het
Arhgef10	C	T	8: 14,997,547	Q1137*	probably null	Het
Asap3	T	A	4: 136,241,570		probably null	Het
Bmp2k	T	C	5: 97,064,961	S568P	unknown	Het
Cacna1e	A	T	1: 154,700,383	V168E	possibly damaging	Het
Ccdc60	T	A	5: 116,126,087	I543F	probably benign	Het
Cd36	T	C	5: 17,814,704	D133G	probably damaging	Het
Chd4	T	C	6: 125,129,985	V1911A	unknown	Het
Cplx4	A	T	18: 65,967,467		probably null	Het
Cyp1a2	A	T	9: 57,678,989	D415E	possibly damaging	Het
Cyp3a57	T	C	5: 145,381,373	I388T	probably damaging	Het
Dnajc5b	T	C	3: 19,546,861		probably null	Het
Dock4	A	T	12: 40,621,286	I35F	probably damaging	Het
Efna4	A	T	3: 89,334,294	L206Q	unknown	Het
Eif2a	T	C	3: 58,541,718		probably null	Het
Fam120a	A	G	13: 48,910,325	F612L	probably damaging	Het
Fbxw21	A	G	9: 109,161,922	L23P	probably damaging	Het
Fcamr	A	T	1: 130,813,212	E456V	probably damaging	Het
Fkbp8	G	A	8: 70,530,994	R106H	probably benign	Het
Galr2	T	A	11: 116,283,048	L168Q	probably damaging	Het
Gm11111	C	T	5: 98,553,540	S22L	unknown	Het
Gm14124	A	G	2: 150,268,269	H293R	possibly damaging	Het
Gm3183	T	A	5: 94,874,782	N107K	possibly damaging	Het
Gnpat	T	C	8: 124,863,269	F11S	possibly damaging	Het
H2-T24	A	T	17: 36,017,452	D46E	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Ifna12	T	C	4: 88,603,203	R36G	probably damaging	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Kif5c	T	A	2: 49,741,361	D683E	probably benign	Het
Krit1	T	C	5: 3,823,651	Y477H	possibly damaging	Het
Lipm	T	A	19: 34,121,323	V399D	possibly damaging	Het
Lrguk	A	T	6: 34,102,139	T770S	probably benign	Het
Lrrc37a	T	C	11: 103,457,955	N2638S	unknown	Het
Lrrc40	T	C	3: 158,036,805	V27A	probably damaging	Het
Map4k1	T	C	7: 28,991,149	V355A	probably benign	Het
Mylk3	T	C	8: 85,364,793	I128V	probably benign	Het
Myo1c	A	G	11: 75,660,963	D289G	probably benign	Het
Mypn	A	G	10: 63,134,958	F889S	probably damaging	Het
Ndufv3	C	T	17: 31,527,433	P99L	possibly damaging	Het
Nlrp10	A	C	7: 108,924,648	S542A	probably benign	Het
Noc2l	T	A	4: 156,247,020	D718E	possibly damaging	Het
Ntng1	T	A	3: 109,851,789	I355F	probably benign	Het
Nup210	A	G	6: 91,060,665	V742A	possibly damaging	Het
Olfr1037	A	T	2: 86,085,595	F61I	probably damaging	Het
Olfr560	A	T	7: 102,753,188	I247N	probably benign	Het
Olig2	T	A	16: 91,226,419	L7Q	probably damaging	Het
Parpbp	A	T	10: 88,093,655	W444R	probably damaging	Het
Plekhg3	A	G	12: 76,578,245	E1287G	probably benign	Het
Pramef25	T	C	4: 143,949,278	D326G	probably damaging	Het
Prrc2b	A	T	2: 32,213,063	Q851L	probably benign	Het
Psg21	C	T	7: 18,654,849	W106*	probably null	Het
Rab18	T	G	18: 6,778,529	D53E	probably benign	Het
Rbm19	T	A	5: 120,123,151		probably null	Het
Rhobtb1	T	C	10: 69,266,297	V136A	probably benign	Het
Rsph4a	G	A	10: 33,909,193	V367I	probably damaging	Het
Sec24b	T	C	3: 129,987,742	N1161S	probably benign	Het
Sgcd	C	A	11: 47,125,601	G145*	probably null	Het
Sin3a	A	G	9: 57,094,471	K134R	probably null	Het
Slc9b2	A	G	3: 135,321,937	E108G	probably benign	Het
Stk24	A	T	14: 121,294,294	S317T	probably benign	Het
Stra8	T	A	6: 34,934,367		probably null	Het
Tmem131	A	G	1: 36,889,295	V71A	possibly damaging	Het
Tmem87a	T	C	2: 120,380,783	D227G	possibly damaging	Het
Vnn1	T	A	10: 23,895,005	L44M	possibly damaging	Het
Wdr20	G	A	12: 110,803,450	V160I	possibly damaging	Het
Zfand4	T	A	6: 116,315,620	N667K	possibly damaging	Het
Zfp609	A	G	9: 65,702,441	V1080A	possibly damaging	Het
Zhx1	C	T	15: 58,054,338	V171I	probably benign	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGGACACAATTGAGTCACAATAG -3'
(R):5'- ATGTGGCTGTGAGACCGTAG -3'

Sequencing Primer
(F):5'- ACAATTGAGTCACAATAGTGGATTG -3'
(R):5'- AATTAGGAATCTCTGGCCATCC -3'

Posted On

2019-05-15