Incidental Mutation 'R7082:Fam171a1'
ID 549579
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7082 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3223475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: V288I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: V288I

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: V168I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: V168I

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: V293I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: V293I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,280 N109Y unknown Het
A430005L14Rik C T 4: 153,959,764 R11W probably damaging Het
Aadacl2 T A 3: 60,024,885 S274T probably damaging Het
Ahctf1 T C 1: 179,775,333 R887G probably benign Het
Aox4 G T 1: 58,224,193 R158L possibly damaging Het
Atp10a T C 7: 58,658,819 I122T probably damaging Het
Batf2 G T 19: 6,171,375 A72S possibly damaging Het
Bptf T C 11: 107,086,747 D749G probably benign Het
Cacybp A G 1: 160,203,659 Y200H probably damaging Het
Cdc40 A T 10: 40,867,873 V76D probably benign Het
Cdc42ep4 T C 11: 113,729,118 D149G probably benign Het
Chtop A G 3: 90,507,584 V9A probably benign Het
Cnot9 A G 1: 74,527,006 I185M probably damaging Het
Col6a5 A G 9: 105,931,239 I870T unknown Het
Cr1l A G 1: 195,123,698 I159T probably benign Het
Cthrc1 T C 15: 39,077,100 S33P probably benign Het
Dlg2 T A 7: 90,731,984 W44R probably benign Het
Dlgap4 T C 2: 156,748,422 probably null Het
Dna2 A G 10: 62,954,317 H193R possibly damaging Het
Espnl T A 1: 91,334,799 F322Y probably benign Het
Fam76b A G 9: 13,833,012 Y135C probably damaging Het
Flvcr2 A T 12: 85,746,954 I35F probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm14548 C T 7: 3,895,511 V313M probably damaging Het
Gm9195 T A 14: 72,442,712 Q2219L probably benign Het
Gm9573 A T 17: 35,621,201 S698T unknown Het
Gnptg T C 17: 25,234,720 T283A probably benign Het
Grap2 G A 15: 80,648,498 V289M probably benign Het
Hk3 T C 13: 55,006,897 T767A probably benign Het
Hs3st5 A G 10: 36,832,837 I123V probably benign Het
Il6st A G 13: 112,504,032 T781A probably damaging Het
Inpp5d T A 1: 87,695,380 H398Q probably damaging Het
Kcnk1 A G 8: 125,995,548 Y30C probably damaging Het
Klhl6 T C 16: 19,982,883 T41A probably benign Het
Krt14 G A 11: 100,203,341 H476Y possibly damaging Het
Lingo3 G C 10: 80,835,791 R102G probably benign Het
Map3k9 G A 12: 81,724,702 T704M probably damaging Het
Mdn1 C A 4: 32,762,341 N5088K probably benign Het
Mmp9 T A 2: 164,948,892 S67T probably benign Het
Mrps18c A G 5: 100,804,404 E143G probably damaging Het
Nags C A 11: 102,147,472 R335S possibly damaging Het
Nars A G 18: 64,504,354 V385A possibly damaging Het
Nipal2 A C 15: 34,584,663 V253G possibly damaging Het
Nos2 C A 11: 78,928,579 T39K probably benign Het
Olfr1411 G A 1: 92,596,418 probably benign Het
Olfr574 T C 7: 102,949,248 V261A probably damaging Het
Olfr601 C A 7: 103,358,288 R302L possibly damaging Het
Olfr796 T A 10: 129,607,547 *311Y probably null Het
Olfr796 T A 10: 129,607,548 *311L probably null Het
Olfr798 C T 10: 129,625,765 V99M probably benign Het
Panx3 G A 9: 37,666,617 P106S probably benign Het
Pappa2 G A 1: 158,763,119 T1655I possibly damaging Het
Pcdhb1 A G 18: 37,266,991 D665G probably damaging Het
Pde2a T C 7: 101,508,096 L676P probably damaging Het
Pf4 A G 5: 90,772,992 T60A possibly damaging Het
Pld5 A T 1: 176,089,876 C164S probably benign Het
Psd3 A T 8: 67,904,148 M640K probably benign Het
Ptf1a A G 2: 19,445,865 D2G possibly damaging Het
Ptprq C T 10: 107,708,730 C313Y probably benign Het
Ranbp10 A G 8: 105,773,946 S467P probably damaging Het
Rap1gap C T 4: 137,718,936 T333M probably damaging Het
Rfpl4 A G 7: 5,115,559 L4P probably benign Het
Rgs12 A G 5: 34,966,706 N611S probably benign Het
Sacs C A 14: 61,210,517 N3337K possibly damaging Het
Sbno2 A T 10: 80,060,090 probably null Het
Scrn2 T A 11: 97,033,082 V264E possibly damaging Het
Serpinb9c T A 13: 33,154,407 I198L probably benign Het
Shank2 T C 7: 144,410,359 F568S probably damaging Het
Slc47a1 C T 11: 61,377,941 R36Q probably benign Het
Slc4a8 A C 15: 100,791,027 E406A probably damaging Het
Speg C T 1: 75,411,447 T1483I probably damaging Het
Srbd1 A G 17: 86,057,732 V632A probably damaging Het
Srd5a2 A T 17: 74,021,520 Y188N probably damaging Het
Sspo A T 6: 48,478,609 probably null Het
Ssx2ip A T 3: 146,430,948 D317V probably benign Het
Tmco3 G T 8: 13,320,847 E172* probably null Het
Trpc4 G A 3: 54,299,098 W573* probably null Het
Ttn T C 2: 76,749,996 I23518V probably benign Het
Tubal3 A G 13: 3,933,050 T277A possibly damaging Het
Uhrf1bp1 G T 17: 27,890,065 R1086L probably damaging Het
Unc5b A T 10: 60,775,088 L391H probably damaging Het
Vmn2r76 A G 7: 86,225,232 F846L probably benign Het
Vps13c T A 9: 67,883,453 Y338N probably damaging Het
Zc3hav1 G T 6: 38,332,393 S498* probably null Het
Zfand4 T A 6: 116,328,376 probably null Het
Zfp451 A T 1: 33,772,891 probably null Het
Zfp607a A T 7: 27,878,758 I418F probably damaging Het
Zfp612 A G 8: 110,089,705 T515A probably damaging Het
Zfp708 G T 13: 67,071,136 L208I possibly damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTACCTTGGGTAAAACAGCC -3'
(R):5'- GTGGGGTCATTTGCAACTTAC -3'

Sequencing Primer
(F):5'- GGTAAAACAGCCATCGTGTCTCTG -3'
(R):5'- GTGGGGTCATTTGCAACTTACATTAC -3'
Posted On 2019-05-15