Incidental Mutation 'R7082:Fam171a1'
ID 549579
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms 9630050M13Rik
MMRRC Submission 045176-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7082 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3115261-3228843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3224512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: V288I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: V288I

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: V168I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: V168I

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: V293I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: V293I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,156,260 (GRCm39) N109Y unknown Het
A430005L14Rik C T 4: 154,044,221 (GRCm39) R11W probably damaging Het
Aadacl2 T A 3: 59,932,306 (GRCm39) S274T probably damaging Het
Ahctf1 T C 1: 179,602,898 (GRCm39) R887G probably benign Het
Aox4 G T 1: 58,263,352 (GRCm39) R158L possibly damaging Het
Atp10a T C 7: 58,308,567 (GRCm39) I122T probably damaging Het
Batf2 G T 19: 6,221,405 (GRCm39) A72S possibly damaging Het
Bltp3a G T 17: 28,109,039 (GRCm39) R1086L probably damaging Het
Bptf T C 11: 106,977,573 (GRCm39) D749G probably benign Het
Cacybp A G 1: 160,031,229 (GRCm39) Y200H probably damaging Het
Cdc40 A T 10: 40,743,869 (GRCm39) V76D probably benign Het
Cdc42ep4 T C 11: 113,619,944 (GRCm39) D149G probably benign Het
Chtop A G 3: 90,414,891 (GRCm39) V9A probably benign Het
Cnot9 A G 1: 74,566,165 (GRCm39) I185M probably damaging Het
Col6a5 A G 9: 105,808,438 (GRCm39) I870T unknown Het
Cr1l A G 1: 194,806,006 (GRCm39) I159T probably benign Het
Cthrc1 T C 15: 38,940,495 (GRCm39) S33P probably benign Het
Dlg2 T A 7: 90,381,192 (GRCm39) W44R probably benign Het
Dlgap4 T C 2: 156,590,342 (GRCm39) probably null Het
Dna2 A G 10: 62,790,096 (GRCm39) H193R possibly damaging Het
Espnl T A 1: 91,262,521 (GRCm39) F322Y probably benign Het
Fam76b A G 9: 13,744,308 (GRCm39) Y135C probably damaging Het
Flvcr2 A T 12: 85,793,728 (GRCm39) I35F probably benign Het
Gm9195 T A 14: 72,680,152 (GRCm39) Q2219L probably benign Het
Gnptg T C 17: 25,453,694 (GRCm39) T283A probably benign Het
Grap2 G A 15: 80,532,699 (GRCm39) V289M probably benign Het
Hk3 T C 13: 55,154,710 (GRCm39) T767A probably benign Het
Hs3st5 A G 10: 36,708,833 (GRCm39) I123V probably benign Het
Il6st A G 13: 112,640,566 (GRCm39) T781A probably damaging Het
Inpp5d T A 1: 87,623,102 (GRCm39) H398Q probably damaging Het
Kcnk1 A G 8: 126,722,287 (GRCm39) Y30C probably damaging Het
Klhl6 T C 16: 19,801,633 (GRCm39) T41A probably benign Het
Krt14 G A 11: 100,094,167 (GRCm39) H476Y possibly damaging Het
Lingo3 G C 10: 80,671,625 (GRCm39) R102G probably benign Het
Map3k9 G A 12: 81,771,476 (GRCm39) T704M probably damaging Het
Mdn1 C A 4: 32,762,341 (GRCm39) N5088K probably benign Het
Mmp9 T A 2: 164,790,812 (GRCm39) S67T probably benign Het
Mrps18c A G 5: 100,952,270 (GRCm39) E143G probably damaging Het
Msantd5f9 G T 4: 73,835,808 (GRCm39) L219M probably benign Het
Muc21 A T 17: 35,932,093 (GRCm39) S698T unknown Het
Nags C A 11: 102,038,298 (GRCm39) R335S possibly damaging Het
Nars1 A G 18: 64,637,425 (GRCm39) V385A possibly damaging Het
Nipal2 A C 15: 34,584,809 (GRCm39) V253G possibly damaging Het
Nos2 C A 11: 78,819,405 (GRCm39) T39K probably benign Het
Or10p1 T A 10: 129,443,416 (GRCm39) *311Y probably null Het
Or10p1 T A 10: 129,443,417 (GRCm39) *311L probably null Het
Or51t4 T C 7: 102,598,455 (GRCm39) V261A probably damaging Het
Or52s19 C A 7: 103,007,495 (GRCm39) R302L possibly damaging Het
Or6c66 C T 10: 129,461,634 (GRCm39) V99M probably benign Het
Or9s15 G A 1: 92,524,140 (GRCm39) probably benign Het
Panx3 G A 9: 37,577,913 (GRCm39) P106S probably benign Het
Pappa2 G A 1: 158,590,689 (GRCm39) T1655I possibly damaging Het
Pcdhb1 A G 18: 37,400,044 (GRCm39) D665G probably damaging Het
Pde2a T C 7: 101,157,303 (GRCm39) L676P probably damaging Het
Pf4 A G 5: 90,920,851 (GRCm39) T60A possibly damaging Het
Pira12 C T 7: 3,898,510 (GRCm39) V313M probably damaging Het
Pld5 A T 1: 175,917,442 (GRCm39) C164S probably benign Het
Psd3 A T 8: 68,356,800 (GRCm39) M640K probably benign Het
Ptf1a A G 2: 19,450,676 (GRCm39) D2G possibly damaging Het
Ptprq C T 10: 107,544,591 (GRCm39) C313Y probably benign Het
Ranbp10 A G 8: 106,500,578 (GRCm39) S467P probably damaging Het
Rap1gap C T 4: 137,446,247 (GRCm39) T333M probably damaging Het
Rfpl4 A G 7: 5,118,558 (GRCm39) L4P probably benign Het
Rgs12 A G 5: 35,124,050 (GRCm39) N611S probably benign Het
Sacs C A 14: 61,447,966 (GRCm39) N3337K possibly damaging Het
Sbno2 A T 10: 79,895,924 (GRCm39) probably null Het
Scrn2 T A 11: 96,923,908 (GRCm39) V264E possibly damaging Het
Serpinb9c T A 13: 33,338,390 (GRCm39) I198L probably benign Het
Shank2 T C 7: 143,964,096 (GRCm39) F568S probably damaging Het
Slc47a1 C T 11: 61,268,767 (GRCm39) R36Q probably benign Het
Slc4a8 A C 15: 100,688,908 (GRCm39) E406A probably damaging Het
Speg C T 1: 75,388,091 (GRCm39) T1483I probably damaging Het
Srbd1 A G 17: 86,365,160 (GRCm39) V632A probably damaging Het
Srd5a2 A T 17: 74,328,515 (GRCm39) Y188N probably damaging Het
Sspo A T 6: 48,455,543 (GRCm39) probably null Het
Ssx2ip A T 3: 146,136,703 (GRCm39) D317V probably benign Het
Tmco3 G T 8: 13,370,847 (GRCm39) E172* probably null Het
Trpc4 G A 3: 54,206,519 (GRCm39) W573* probably null Het
Ttn T C 2: 76,580,340 (GRCm39) I23518V probably benign Het
Tubal3 A G 13: 3,983,050 (GRCm39) T277A possibly damaging Het
Unc5b A T 10: 60,610,867 (GRCm39) L391H probably damaging Het
Vmn2r76 A G 7: 85,874,440 (GRCm39) F846L probably benign Het
Vps13c T A 9: 67,790,735 (GRCm39) Y338N probably damaging Het
Zc3hav1 G T 6: 38,309,328 (GRCm39) S498* probably null Het
Zfand4 T A 6: 116,305,337 (GRCm39) probably null Het
Zfp451 A T 1: 33,811,972 (GRCm39) probably null Het
Zfp607a A T 7: 27,578,183 (GRCm39) I418F probably damaging Het
Zfp612 A G 8: 110,816,337 (GRCm39) T515A probably damaging Het
Zfp708 G T 13: 67,219,200 (GRCm39) L208I possibly damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3,179,327 (GRCm39) missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3,203,657 (GRCm39) missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3,203,663 (GRCm39) missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3,224,623 (GRCm39) critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3,224,527 (GRCm39) missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3,203,612 (GRCm39) missense possibly damaging 0.83
ghosted UTSW 2 3,226,189 (GRCm39) nonsense probably null
R0167:Fam171a1 UTSW 2 3,187,469 (GRCm39) missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0468:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0811:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3,226,354 (GRCm39) missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3,226,660 (GRCm39) missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3,179,410 (GRCm39) missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3,227,189 (GRCm39) missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3,221,380 (GRCm39) missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3,226,656 (GRCm39) nonsense probably null
R2355:Fam171a1 UTSW 2 3,226,570 (GRCm39) nonsense probably null
R3690:Fam171a1 UTSW 2 3,227,393 (GRCm39) missense probably benign
R3723:Fam171a1 UTSW 2 3,221,412 (GRCm39) splice site probably benign
R3978:Fam171a1 UTSW 2 3,226,072 (GRCm39) missense probably benign
R4087:Fam171a1 UTSW 2 3,227,333 (GRCm39) missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3,221,328 (GRCm39) missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3,225,946 (GRCm39) missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3,224,550 (GRCm39) missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3,226,615 (GRCm39) missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3,224,546 (GRCm39) missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3,179,505 (GRCm39) splice site probably null
R5137:Fam171a1 UTSW 2 3,226,426 (GRCm39) missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3,224,582 (GRCm39) missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3,179,390 (GRCm39) missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3,226,654 (GRCm39) missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3,226,334 (GRCm39) missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3,227,126 (GRCm39) missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3,226,374 (GRCm39) missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3,227,392 (GRCm39) missense probably benign 0.24
R7141:Fam171a1 UTSW 2 3,226,189 (GRCm39) nonsense probably null
R7155:Fam171a1 UTSW 2 3,226,766 (GRCm39) missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3,119,653 (GRCm39) missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3,227,509 (GRCm39) nonsense probably null
R7477:Fam171a1 UTSW 2 3,226,676 (GRCm39) missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3,221,391 (GRCm39) missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3,226,483 (GRCm39) missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3,179,354 (GRCm39) missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3,226,421 (GRCm39) missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3,179,298 (GRCm39) missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3,221,352 (GRCm39) missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3,187,535 (GRCm39) missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3,221,344 (GRCm39) missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3,226,940 (GRCm39) missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3,227,434 (GRCm39) missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3,226,525 (GRCm39) missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3,226,037 (GRCm39) missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3,226,630 (GRCm39) missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3,225,971 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTACCTTGGGTAAAACAGCC -3'
(R):5'- GTGGGGTCATTTGCAACTTAC -3'

Sequencing Primer
(F):5'- GGTAAAACAGCCATCGTGTCTCTG -3'
(R):5'- GTGGGGTCATTTGCAACTTACATTAC -3'
Posted On 2019-05-15