Mutagenetix > Incidental Mutations

Incidental Mutation 'R0614:Otogl'

54959

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107798355 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1420 (P1420S)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

Predicted Effect

probably benign
Transcript: ENSMUST00000165341
AA Change: P1420S

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: P1420S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.0859

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7947:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7962:Otogl	UTSW	10	107777109	missense	probably benign	0.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGAAAGCCAACTTCATAACTCCGTT -3'
(R):5'- ATGCTTGCCATATTGCCCCAAGA -3'

Sequencing Primer
(F):5'- GAAACCTTAGTAGCATACACTAACTG -3'
(R):5'- aaacaaacaaacaaaaaaacccaac -3'

Posted On

2013-07-11