Incidental Mutation 'R7082:Zc3hav1'
ID549595
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7082 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 38332393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 498 (S498*)
Ref Sequence ENSEMBL: ENSMUSP00000144312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031850] [ENSMUST00000114898] [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably null
Transcript: ENSMUST00000031850
AA Change: S498*
SMART Domains Protein: ENSMUSP00000031850
Gene: ENSMUSG00000029826
AA Change: S498*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 9.6e-6 PROSPERO
internal_repeat_1 166 208 9.6e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114898
SMART Domains Protein: ENSMUSP00000110548
Gene: ENSMUSG00000029826

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 8.18e-6 PROSPERO
internal_repeat_1 166 208 8.18e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114900
AA Change: S498*
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: S498*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143702
AA Change: S498*
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826
AA Change: S498*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,280 N109Y unknown Het
A430005L14Rik C T 4: 153,959,764 R11W probably damaging Het
Aadacl2 T A 3: 60,024,885 S274T probably damaging Het
Ahctf1 T C 1: 179,775,333 R887G probably benign Het
Aox4 G T 1: 58,224,193 R158L possibly damaging Het
Atp10a T C 7: 58,658,819 I122T probably damaging Het
Batf2 G T 19: 6,171,375 A72S possibly damaging Het
Bptf T C 11: 107,086,747 D749G probably benign Het
Cacybp A G 1: 160,203,659 Y200H probably damaging Het
Cdc40 A T 10: 40,867,873 V76D probably benign Het
Cdc42ep4 T C 11: 113,729,118 D149G probably benign Het
Chtop A G 3: 90,507,584 V9A probably benign Het
Cnot9 A G 1: 74,527,006 I185M probably damaging Het
Col6a5 A G 9: 105,931,239 I870T unknown Het
Cr1l A G 1: 195,123,698 I159T probably benign Het
Cthrc1 T C 15: 39,077,100 S33P probably benign Het
Dlg2 T A 7: 90,731,984 W44R probably benign Het
Dlgap4 T C 2: 156,748,422 probably null Het
Dna2 A G 10: 62,954,317 H193R possibly damaging Het
Espnl T A 1: 91,334,799 F322Y probably benign Het
Fam171a1 G A 2: 3,223,475 V293I probably benign Het
Fam76b A G 9: 13,833,012 Y135C probably damaging Het
Flvcr2 A T 12: 85,746,954 I35F probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm14548 C T 7: 3,895,511 V313M probably damaging Het
Gm9195 T A 14: 72,442,712 Q2219L probably benign Het
Gm9573 A T 17: 35,621,201 S698T unknown Het
Gnptg T C 17: 25,234,720 T283A probably benign Het
Grap2 G A 15: 80,648,498 V289M probably benign Het
Hk3 T C 13: 55,006,897 T767A probably benign Het
Hs3st5 A G 10: 36,832,837 I123V probably benign Het
Il6st A G 13: 112,504,032 T781A probably damaging Het
Inpp5d T A 1: 87,695,380 H398Q probably damaging Het
Kcnk1 A G 8: 125,995,548 Y30C probably damaging Het
Klhl6 T C 16: 19,982,883 T41A probably benign Het
Krt14 G A 11: 100,203,341 H476Y possibly damaging Het
Lingo3 G C 10: 80,835,791 R102G probably benign Het
Map3k9 G A 12: 81,724,702 T704M probably damaging Het
Mdn1 C A 4: 32,762,341 N5088K probably benign Het
Mmp9 T A 2: 164,948,892 S67T probably benign Het
Mrps18c A G 5: 100,804,404 E143G probably damaging Het
Nags C A 11: 102,147,472 R335S possibly damaging Het
Nars A G 18: 64,504,354 V385A possibly damaging Het
Nipal2 A C 15: 34,584,663 V253G possibly damaging Het
Nos2 C A 11: 78,928,579 T39K probably benign Het
Olfr1411 G A 1: 92,596,418 probably benign Het
Olfr574 T C 7: 102,949,248 V261A probably damaging Het
Olfr601 C A 7: 103,358,288 R302L possibly damaging Het
Olfr796 T A 10: 129,607,547 *311Y probably null Het
Olfr796 T A 10: 129,607,548 *311L probably null Het
Olfr798 C T 10: 129,625,765 V99M probably benign Het
Panx3 G A 9: 37,666,617 P106S probably benign Het
Pappa2 G A 1: 158,763,119 T1655I possibly damaging Het
Pcdhb1 A G 18: 37,266,991 D665G probably damaging Het
Pde2a T C 7: 101,508,096 L676P probably damaging Het
Pf4 A G 5: 90,772,992 T60A possibly damaging Het
Pld5 A T 1: 176,089,876 C164S probably benign Het
Psd3 A T 8: 67,904,148 M640K probably benign Het
Ptf1a A G 2: 19,445,865 D2G possibly damaging Het
Ptprq C T 10: 107,708,730 C313Y probably benign Het
Ranbp10 A G 8: 105,773,946 S467P probably damaging Het
Rap1gap C T 4: 137,718,936 T333M probably damaging Het
Rfpl4 A G 7: 5,115,559 L4P probably benign Het
Rgs12 A G 5: 34,966,706 N611S probably benign Het
Sacs C A 14: 61,210,517 N3337K possibly damaging Het
Sbno2 A T 10: 80,060,090 probably null Het
Scrn2 T A 11: 97,033,082 V264E possibly damaging Het
Serpinb9c T A 13: 33,154,407 I198L probably benign Het
Shank2 T C 7: 144,410,359 F568S probably damaging Het
Slc47a1 C T 11: 61,377,941 R36Q probably benign Het
Slc4a8 A C 15: 100,791,027 E406A probably damaging Het
Speg C T 1: 75,411,447 T1483I probably damaging Het
Srbd1 A G 17: 86,057,732 V632A probably damaging Het
Srd5a2 A T 17: 74,021,520 Y188N probably damaging Het
Sspo A T 6: 48,478,609 probably null Het
Ssx2ip A T 3: 146,430,948 D317V probably benign Het
Tmco3 G T 8: 13,320,847 E172* probably null Het
Trpc4 G A 3: 54,299,098 W573* probably null Het
Ttn T C 2: 76,749,996 I23518V probably benign Het
Tubal3 A G 13: 3,933,050 T277A possibly damaging Het
Uhrf1bp1 G T 17: 27,890,065 R1086L probably damaging Het
Unc5b A T 10: 60,775,088 L391H probably damaging Het
Vmn2r76 A G 7: 86,225,232 F846L probably benign Het
Vps13c T A 9: 67,883,453 Y338N probably damaging Het
Zfand4 T A 6: 116,328,376 probably null Het
Zfp451 A T 1: 33,772,891 probably null Het
Zfp607a A T 7: 27,878,758 I418F probably damaging Het
Zfp612 A G 8: 110,089,705 T515A probably damaging Het
Zfp708 G T 13: 67,071,136 L208I possibly damaging Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
R7968:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7975:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTTACACTCAGCAGGGTCTG -3'
(R):5'- TGTGGCTAAGACCCAGGATC -3'

Sequencing Primer
(F):5'- TCAGCAGGGTCTGACATCATC -3'
(R):5'- GCTAAGACCCAGGATCCCCAG -3'
Posted On2019-05-15