Mutagenetix > Incidental Mutations

Incidental Mutation 'R0614:Llgl2'

54961

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.674) question?

Stock #

R0614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115850267 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 502 (D502E)

Ref Sequence

ENSEMBL: ENSMUSP00000099321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000173289] [ENSMUST00000177736]

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: D502E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: D502E

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132999

Predicted Effect

probably benign
Transcript: ENSMUST00000133250

SMART Domains

Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	146	1e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137900

SMART Domains

Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	3e-20	BLAST
SCOP:d1gxra_	19	158	7e-9	SMART
Blast:WD40	62	101	6e-22	BLAST
Blast:WD40	112	157	2e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

probably benign
Transcript: ENSMUST00000155878

SMART Domains

Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	1e-20	BLAST
SCOP:d1gxra_	19	118	3e-8	SMART
Blast:WD40	62	101	3e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173289

SMART Domains

Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	148	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000177736
AA Change: D502E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: D502E

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
R8076:Llgl2	UTSW	11	115846929	missense	possibly damaging	0.69
R8109:Llgl2	UTSW	11	115850793	missense	possibly damaging	0.52
R8129:Llgl2	UTSW	11	115850911	splice site	probably null
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGTCTGCTCTACAAACTGAGCAC -3'
(R):5'- TCTGGGGTCACGCTAATCTAGCAC -3'

Sequencing Primer
(F):5'- TCTACAAACTGAGCACTGTGAG -3'
(R):5'- TGCCTCTGCTAGGAAAAGC -3'

Posted On

2013-07-11