Incidental Mutation 'R0614:Card14'
ID54964
Institutional Source Beutler Lab
Gene Symbol Card14
Ensembl Gene ENSMUSG00000013483
Gene Namecaspase recruitment domain family, member 14
SynonymsBimp2, CARMA2
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0614 (G1)
Quality Score212
Status Validated
Chromosome11
Chromosomal Location119307768-119345375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119322827 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 200 (N200S)
Ref Sequence ENSEMBL: ENSMUSP00000101857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]
Predicted Effect probably benign
Transcript: ENSMUST00000053245
AA Change: N200S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483
AA Change: N200S

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106250
AA Change: N200S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483
AA Change: N200S

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151052
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Card14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Card14 APN 11 119343145 missense probably benign 0.10
IGL02070:Card14 APN 11 119344704 missense probably damaging 1.00
IGL02632:Card14 APN 11 119338904 missense probably benign 0.02
R0183:Card14 UTSW 11 119326698 missense probably damaging 1.00
R0766:Card14 UTSW 11 119324176 missense probably damaging 1.00
R1033:Card14 UTSW 11 119338370 missense probably damaging 1.00
R1705:Card14 UTSW 11 119338406 missense possibly damaging 0.77
R1907:Card14 UTSW 11 119331259 missense probably benign 0.00
R1992:Card14 UTSW 11 119321821 critical splice acceptor site probably null
R3729:Card14 UTSW 11 119333932 missense probably damaging 1.00
R4472:Card14 UTSW 11 119333958 missense possibly damaging 0.77
R4578:Card14 UTSW 11 119326741 missense probably benign 0.20
R4763:Card14 UTSW 11 119343175 missense probably damaging 0.99
R5117:Card14 UTSW 11 119338250 missense probably damaging 0.99
R5386:Card14 UTSW 11 119317289 missense probably damaging 1.00
R6457:Card14 UTSW 11 119339602 nonsense probably null
R6622:Card14 UTSW 11 119333988 missense probably benign 0.06
R6998:Card14 UTSW 11 119322899 missense probably damaging 1.00
R7269:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7304:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7310:Card14 UTSW 11 119326179 missense probably null 1.00
R7612:Card14 UTSW 11 119333579 missense possibly damaging 0.52
R7689:Card14 UTSW 11 119325502 missense possibly damaging 0.66
Z1177:Card14 UTSW 11 119341061 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGAGACATCCAAGCTGACCGAG -3'
(R):5'- TGGCATTCCTGGAAGGAAGCAC -3'

Sequencing Primer
(F):5'- CAAGCTGACCGAGTGTCTG -3'
(R):5'- CCTGGAAGGAAGCACCCATAAG -3'
Posted On2013-07-11