Mutagenetix > Incidental Mutations

Incidental Mutation 'R0614:Card14'

54964

Institutional Source

Beutler Lab

Gene Symbol

Card14

Ensembl Gene

ENSMUSG00000013483

Gene Name

caspase recruitment domain family, member 14

Synonyms

Bimp2, CARMA2

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R0614 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

119307768-119345375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119322827 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 200 (N200S)

Ref Sequence

ENSEMBL: ENSMUSP00000101857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]

Predicted Effect

probably benign
Transcript: ENSMUST00000053245
AA Change: N200S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483
AA Change: N200S

Domain	Start	End	E-Value	Type
Pfam:CARD	20	106	4.1e-25	PFAM
coiled coil region	126	173	N/A	INTRINSIC
low complexity region	240	250	N/A	INTRINSIC
low complexity region	262	275	N/A	INTRINSIC
coiled coil region	280	377	N/A	INTRINSIC
low complexity region	438	450	N/A	INTRINSIC
low complexity region	473	483	N/A	INTRINSIC
low complexity region	541	551	N/A	INTRINSIC
PDZ	578	657	5.51e-3	SMART
Blast:SH3	676	735	4e-25	BLAST
low complexity region	736	746	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC
Blast:GuKc	826	989	4e-63	BLAST
SCOP:d1kjwa2	855	994	2e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106250
AA Change: N200S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483
AA Change: N200S

Domain	Start	End	E-Value	Type
Pfam:CARD	20	106	2.8e-25	PFAM
coiled coil region	126	173	N/A	INTRINSIC
low complexity region	240	250	N/A	INTRINSIC
low complexity region	262	275	N/A	INTRINSIC
coiled coil region	280	377	N/A	INTRINSIC
low complexity region	438	450	N/A	INTRINSIC
low complexity region	473	483	N/A	INTRINSIC
low complexity region	541	551	N/A	INTRINSIC
PDZ	578	657	5.51e-3	SMART
Blast:SH3	676	735	4e-25	BLAST
low complexity region	736	746	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC
Blast:GuKc	826	989	4e-63	BLAST
SCOP:d1kjwa2	855	994	2e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151052

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Card14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01916:Card14	APN	11	119343145	missense	probably benign	0.10
IGL02070:Card14	APN	11	119344704	missense	probably damaging	1.00
IGL02632:Card14	APN	11	119338904	missense	probably benign	0.02
R0183:Card14	UTSW	11	119326698	missense	probably damaging	1.00
R0766:Card14	UTSW	11	119324176	missense	probably damaging	1.00
R1033:Card14	UTSW	11	119338370	missense	probably damaging	1.00
R1705:Card14	UTSW	11	119338406	missense	possibly damaging	0.77
R1907:Card14	UTSW	11	119331259	missense	probably benign	0.00
R1992:Card14	UTSW	11	119321821	critical splice acceptor site	probably null
R3729:Card14	UTSW	11	119333932	missense	probably damaging	1.00
R4472:Card14	UTSW	11	119333958	missense	possibly damaging	0.77
R4578:Card14	UTSW	11	119326741	missense	probably benign	0.20
R4763:Card14	UTSW	11	119343175	missense	probably damaging	0.99
R5117:Card14	UTSW	11	119338250	missense	probably damaging	0.99
R5386:Card14	UTSW	11	119317289	missense	probably damaging	1.00
R6457:Card14	UTSW	11	119339602	nonsense	probably null
R6622:Card14	UTSW	11	119333988	missense	probably benign	0.06
R6998:Card14	UTSW	11	119322899	missense	probably damaging	1.00
R7269:Card14	UTSW	11	119337747	missense	probably damaging	1.00
R7304:Card14	UTSW	11	119337747	missense	probably damaging	1.00
R7310:Card14	UTSW	11	119326179	missense	probably null	1.00
R7612:Card14	UTSW	11	119333579	missense	possibly damaging	0.52
R7689:Card14	UTSW	11	119325502	missense	possibly damaging	0.66
Z1177:Card14	UTSW	11	119341061	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATGGAGACATCCAAGCTGACCGAG -3'
(R):5'- TGGCATTCCTGGAAGGAAGCAC -3'

Sequencing Primer
(F):5'- CAAGCTGACCGAGTGTCTG -3'
(R):5'- CCTGGAAGGAAGCACCCATAAG -3'

Posted On

2013-07-11