Incidental Mutation 'R7083:Gpr39'
ID549656
Institutional Source Beutler Lab
Gene Symbol Gpr39
Ensembl Gene ENSMUSG00000026343
Gene NameG protein-coupled receptor 39
Synonyms4933415E13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7083 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location125676995-125873862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125677418 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 28 (W28R)
Ref Sequence ENSEMBL: ENSMUSP00000027581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027581]
Predicted Effect probably damaging
Transcript: ENSMUST00000027581
AA Change: W28R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027581
Gene: ENSMUSG00000026343
AA Change: W28R

DomainStartEndE-ValueType
Pfam:7tm_1 47 344 1.2e-36 PFAM
low complexity region 397 406 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ghrelin receptor family and encodes a rhodopsin-type G-protein-coupled receptor (GPCR). The encoded protein is involved in zinc-dependent signaling in epithelial tissue in intestines, prostate and salivary glands. The protein may also be involved in the pathophysiology of depression. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null mutation display abnormal glucose homeostasis when fed a high sugar diet. Mice homozygous for a different null allele have accelerated gastric emptying, decreased fasting-induced hyperphagia, and increasedbody weight after oneyear of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Gpr39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gpr39 APN 1 125872731 missense probably benign 0.00
IGL01593:Gpr39 APN 1 125677451 missense probably benign 0.00
IGL03051:Gpr39 APN 1 125677748 missense probably damaging 1.00
R0110:Gpr39 UTSW 1 125677500 missense probably damaging 1.00
R0469:Gpr39 UTSW 1 125677500 missense probably damaging 1.00
R1438:Gpr39 UTSW 1 125872356 utr 3 prime probably benign
R1543:Gpr39 UTSW 1 125872424 missense probably damaging 0.97
R1762:Gpr39 UTSW 1 125872549 missense possibly damaging 0.93
R2105:Gpr39 UTSW 1 125677884 missense possibly damaging 0.95
R2291:Gpr39 UTSW 1 125677541 missense probably benign 0.13
R3708:Gpr39 UTSW 1 125872612 missense probably damaging 1.00
R4281:Gpr39 UTSW 1 125677991 missense probably benign 0.34
R4502:Gpr39 UTSW 1 125677991 missense probably benign 0.34
R4503:Gpr39 UTSW 1 125677991 missense probably benign 0.34
R4547:Gpr39 UTSW 1 125677991 missense probably benign 0.34
R4548:Gpr39 UTSW 1 125677991 missense probably benign 0.34
R5198:Gpr39 UTSW 1 125677436 missense probably benign
R6148:Gpr39 UTSW 1 125872586 missense probably damaging 1.00
R7059:Gpr39 UTSW 1 125677959 missense probably damaging 1.00
R7147:Gpr39 UTSW 1 125872501 missense possibly damaging 0.91
R7761:Gpr39 UTSW 1 125677512 missense probably damaging 0.99
R7772:Gpr39 UTSW 1 125677597 missense possibly damaging 0.83
R7887:Gpr39 UTSW 1 125677542 missense probably damaging 0.99
R7970:Gpr39 UTSW 1 125677542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTAAGTCACTCCTGGCC -3'
(R):5'- ACTCCATGGGCATGCCAATC -3'

Sequencing Primer
(F):5'- AAAAGTGTTGCGCCCACG -3'
(R):5'- TCCATGGGCATGCCAATCAAAAAG -3'
Posted On2019-05-15