Mutagenetix > Incidental Mutation

Incidental Mutation 'R7083:Rasef'

549664

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R7083 (G1)

Quality Score

151.008

Status

Not validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73790984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 4 (D4G)

Ref Sequence

ENSEMBL: ENSMUSP00000152127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably benign
Transcript: ENSMUST00000058292

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102837

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222414
AA Change: D4G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	A	T	12: 81,560,241	M249K	possibly damaging	Het
Arhgef38	T	A	3: 133,132,436	Q613L	unknown	Het
Arpp21	A	G	9: 112,183,544	V70A	probably benign	Het
AW551984	T	C	9: 39,597,647	N327S	probably damaging	Het
Bnc1	T	C	7: 81,973,310	K723R	probably damaging	Het
Btbd7	A	G	12: 102,788,335	L724P	probably damaging	Het
Btnl10	G	T	11: 58,919,137	V35F	probably damaging	Het
Cd22	T	A	7: 30,868,048	T704S	probably damaging	Het
Cd4	T	G	6: 124,870,572	S210R	probably benign	Het
Cped1	A	G	6: 22,123,580	Q444R	probably benign	Het
Dusp26	A	G	8: 31,091,719		probably benign	Het
Dync1i1	C	T	6: 5,969,429	A418V	probably damaging	Het
Fibp	A	G	19: 5,463,631	D232G	probably damaging	Het
Frem2	T	A	3: 53,537,493	T2406S	probably damaging	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gpr39	T	A	1: 125,677,418	W28R	probably damaging	Het
Greb1	A	G	12: 16,723,314	V253A	probably benign	Het
Hexim1	T	G	11: 103,117,166	L82W	possibly damaging	Het
Hmga1	G	T	17: 27,560,971	R49L	possibly damaging	Het
Itch	A	T	2: 155,210,444	N655Y	probably damaging	Het
Izumo2	A	G	7: 44,710,333	E129G	probably damaging	Het
Klk1b24	G	A	7: 44,191,801	C186Y	probably damaging	Het
Lnx1	G	A	5: 74,628,185	S31F	possibly damaging	Het
Lrmp	A	T	6: 145,169,783	N349I	probably damaging	Het
Lrrc37a	T	C	11: 103,503,340	I420V	probably benign	Het
Ltk	A	C	2: 119,752,074	C776G	probably damaging	Het
Mast4	A	C	13: 102,737,715	L1715R	probably damaging	Het
Med28	T	C	5: 45,523,536		probably null	Het
Naf1	GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA	GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA	8: 66,860,486		probably benign	Het
Nckap1l	C	A	15: 103,482,124	T774K	probably damaging	Het
Nfkbiz	T	C	16: 55,818,300	K266E	possibly damaging	Het
Ntrk3	T	A	7: 78,250,839	D584V	probably damaging	Het
Olfr107	T	C	17: 37,406,172	V208A	probably benign	Het
Olfr1261	A	G	2: 89,993,857	I155V	probably benign	Het
Olfr132	T	A	17: 38,130,710	T161S	probably benign	Het
Olfr193	T	C	16: 59,110,037	D191G	probably damaging	Het
Olfr733	G	A	14: 50,299,279	T10I	possibly damaging	Het
Picalm	T	A	7: 90,176,768	I376K	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prps1l3	A	T	12: 57,239,248	I275L	probably benign	Het
Psg26	G	A	7: 18,480,009	R243*	probably null	Het
Ranbp2	A	G	10: 58,479,230	H1924R	probably damaging	Het
Rttn	T	C	18: 89,090,598	L1642P	probably damaging	Het
Shroom3	T	C	5: 92,964,525	L1915P	probably damaging	Het
Slc26a10	A	G	10: 127,177,168	V319A	probably damaging	Het
Slc4a10	A	G	2: 62,234,495	N231S	probably benign	Het
Sox18	T	C	2: 181,670,372	Q322R	possibly damaging	Het
Syde1	G	T	10: 78,587,069	P490T	probably benign	Het
Syne2	A	G	12: 75,943,888	I1881M	probably damaging	Het
Taf1c	T	C	8: 119,600,668	D387G	probably damaging	Het
Tenm4	T	A	7: 96,895,349	Y2228N	probably damaging	Het
Tmem173	T	C	18: 35,734,650	H331R	probably damaging	Het
Tubgcp5	C	T	7: 55,800,695	Q185*	probably null	Het
Vmn2r44	T	A	7: 8,378,370	I175F	probably benign	Het
Zdhhc7	C	A	8: 120,085,427	C152F	probably damaging	Het
Zfp52	T	A	17: 21,560,130	M80K	possibly damaging	Het
Zfp612	T	C	8: 110,089,136	I325T	probably damaging	Het
Zmiz1	T	G	14: 25,651,948	F597V	probably damaging	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AATGAGTTGGGCCTCGTCTC -3'
(R):5'- GAGCTTACTCACAGGAAGGTGAC -3'

Sequencing Primer
(F):5'- ACTCCGGGAAGGTGATGGC -3'
(R):5'- TTACTCACAGGAAGGTGACCAGTG -3'

Posted On

2019-05-15