Incidental Mutation 'R0614:Hif1a'
ID54967
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Namehypoxia inducible factor 1, alpha subunit
SynonymsbHLHe78, HIF1alpha, MOP1, HIF-1alpha
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73901375-73947530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73945631 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 787 (N787K)
Ref Sequence ENSEMBL: ENSMUSP00000106088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461]
Predicted Effect probably damaging
Transcript: ENSMUST00000021530
AA Change: N813K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: N813K

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110461
AA Change: N787K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: N787K

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Meta Mutation Damage Score 0.8395 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73942010 missense probably damaging 1.00
IGL01396:Hif1a APN 12 73940533 missense probably benign 0.00
IGL02230:Hif1a APN 12 73932450 missense probably damaging 1.00
IGL02561:Hif1a APN 12 73942206 missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73930771 critical splice donor site probably null
IGL03027:Hif1a APN 12 73940477 missense probably benign 0.03
lightweight UTSW 12 73941800 missense probably damaging 1.00
R0597:Hif1a UTSW 12 73942275 missense probably benign 0.00
R0678:Hif1a UTSW 12 73944191 splice site probably null
R0967:Hif1a UTSW 12 73937670 missense possibly damaging 0.91
R1351:Hif1a UTSW 12 73940461 missense probably benign 0.00
R1387:Hif1a UTSW 12 73942292 missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73944155 missense probably benign
R2105:Hif1a UTSW 12 73937745 missense probably damaging 1.00
R2194:Hif1a UTSW 12 73930747 missense probably damaging 0.98
R4825:Hif1a UTSW 12 73932401 missense probably damaging 1.00
R4924:Hif1a UTSW 12 73939557 missense probably damaging 1.00
R5386:Hif1a UTSW 12 73944093 missense probably benign 0.02
R5594:Hif1a UTSW 12 73937792 nonsense probably null
R5722:Hif1a UTSW 12 73941759 missense probably benign 0.00
R5818:Hif1a UTSW 12 73939564 missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73942144 missense probably benign
R6026:Hif1a UTSW 12 73932281 missense probably damaging 1.00
R6059:Hif1a UTSW 12 73941800 missense probably damaging 1.00
R6084:Hif1a UTSW 12 73941842 missense probably damaging 0.99
R6818:Hif1a UTSW 12 73945563 nonsense probably null
R6878:Hif1a UTSW 12 73928281 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TAGGGTTTGCCCAGGGGACTAAAG -3'
(R):5'- TGGCTACCATGTACTGCTGACAAAG -3'

Sequencing Primer
(F):5'- CAGGGGACTAAAGCCCTTC -3'
(R):5'- TAGACTGCTGAGCCACCAG -3'
Posted On2013-07-11