Incidental Mutation 'R7083:Bnc1'
ID549679
Institutional Source Beutler Lab
Gene Symbol Bnc1
Ensembl Gene ENSMUSG00000025105
Gene Namebasonuclin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7083 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81966672-81992292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81973310 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 723 (K723R)
Ref Sequence ENSEMBL: ENSMUSP00000026096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026096]
Predicted Effect probably damaging
Transcript: ENSMUST00000026096
AA Change: K723R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: K723R

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
ZnF_C2H2 354 377 1.43e-1 SMART
ZnF_C2H2 382 411 6.75e0 SMART
low complexity region 505 514 N/A INTRINSIC
low complexity region 541 554 N/A INTRINSIC
low complexity region 570 583 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
ZnF_C2H2 716 739 1.47e-3 SMART
ZnF_C2H2 744 771 5.62e0 SMART
low complexity region 855 876 N/A INTRINSIC
ZnF_C2H2 924 947 3.11e-2 SMART
ZnF_C2H2 952 979 8.09e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Bnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Bnc1 APN 7 81973707 nonsense probably null
IGL01293:Bnc1 APN 7 81974489 missense probably damaging 0.99
IGL02064:Bnc1 APN 7 81973503 missense probably benign 0.00
IGL02529:Bnc1 APN 7 81977368 missense probably damaging 0.99
IGL03087:Bnc1 APN 7 81974642 missense possibly damaging 0.86
R0088:Bnc1 UTSW 7 81978498 missense possibly damaging 0.52
R0312:Bnc1 UTSW 7 81977324 missense possibly damaging 0.95
R0631:Bnc1 UTSW 7 81974366 missense probably damaging 0.99
R0924:Bnc1 UTSW 7 81978408 splice site probably benign
R0928:Bnc1 UTSW 7 81973502 missense probably benign
R1967:Bnc1 UTSW 7 81973636 missense probably benign 0.03
R2243:Bnc1 UTSW 7 81974073 missense possibly damaging 0.59
R2404:Bnc1 UTSW 7 81968715 missense probably benign 0.08
R4079:Bnc1 UTSW 7 81973760 missense probably damaging 0.99
R4416:Bnc1 UTSW 7 81968960 missense probably benign
R5038:Bnc1 UTSW 7 81968714 missense probably damaging 1.00
R5055:Bnc1 UTSW 7 81974415 missense probably damaging 0.99
R7117:Bnc1 UTSW 7 81973361 missense possibly damaging 0.92
R7151:Bnc1 UTSW 7 81973307 missense possibly damaging 0.71
R7386:Bnc1 UTSW 7 81974492 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATCATGCCTTTCCAGGTCATG -3'
(R):5'- CTACATGGAGTTGCAGCAGC -3'

Sequencing Primer
(F):5'- ACATCTACAGAGCTGTGCTTCAGG -3'
(R):5'- AGTTGCAGCAGCGCCTG -3'
Posted On2019-05-15