Incidental Mutation 'R7083:Gm40460'
ID549682
Institutional Source Beutler Lab
Gene Symbol Gm40460
Ensembl Gene ENSMUSG00000110324
Gene Namepredicted gene, 40460
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7083 (G1)
Quality Score180.459
Status Not validated
Chromosome7
Chromosomal Location142240344-142241078 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG at 142240713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147331 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000211591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Gm40460
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6822:Gm40460 UTSW 7 142240713 small deletion probably benign
R7016:Gm40460 UTSW 7 142240817 small deletion probably benign
R7053:Gm40460 UTSW 7 142240817 small deletion probably benign
R7087:Gm40460 UTSW 7 142240434 small deletion probably benign
R7110:Gm40460 UTSW 7 142240817 small deletion probably benign
R7184:Gm40460 UTSW 7 142240713 small deletion probably benign
R7224:Gm40460 UTSW 7 142240434 small deletion probably benign
R7367:Gm40460 UTSW 7 142240434 small deletion probably benign
R7411:Gm40460 UTSW 7 142240817 small deletion probably benign
R7481:Gm40460 UTSW 7 142240817 small deletion probably benign
R7491:Gm40460 UTSW 7 142240713 small deletion probably benign
R7553:Gm40460 UTSW 7 142240713 small deletion probably benign
R7637:Gm40460 UTSW 7 142240713 small deletion probably benign
R7643:Gm40460 UTSW 7 142240713 small deletion probably benign
R7663:Gm40460 UTSW 7 142240713 small deletion probably benign
R7785:Gm40460 UTSW 7 142240434 small deletion probably benign
R7871:Gm40460 UTSW 7 142240817 small deletion probably benign
R7895:Gm40460 UTSW 7 142240713 small deletion probably benign
R8054:Gm40460 UTSW 7 142240817 small deletion probably benign
R8355:Gm40460 UTSW 7 142240817 small deletion probably benign
R8389:Gm40460 UTSW 7 142240434 small deletion probably benign
R8501:Gm40460 UTSW 7 142240713 small deletion probably benign
R8509:Gm40460 UTSW 7 142240817 small deletion probably benign
RF040:Gm40460 UTSW 7 142240817 small deletion probably benign
Z1177:Gm40460 UTSW 7 142240772 missense unknown
Z1177:Gm40460 UTSW 7 142240906 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTCAGATCTTGCACTGGC -3'
(R):5'- TGCAAGGGAGGCTGTAGTTC -3'

Sequencing Primer
(F):5'- AGCAGCAGGGCTTACAGC -3'
(R):5'- CAAGGGAGGCTGTAGTTCCTGTG -3'
Posted On2019-05-15