Incidental Mutation 'R7083:Ranbp2'
ID549691
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7083 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58479230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1924 (H1924R)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably damaging
Transcript: ENSMUST00000003310
AA Change: H1924R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: H1924R

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7934:Ranbp2 UTSW 10 58476475 missense probably damaging 0.98
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
R8100:Ranbp2 UTSW 10 58490648 missense possibly damaging 0.58
R8194:Ranbp2 UTSW 10 58455925 missense possibly damaging 0.84
R8258:Ranbp2 UTSW 10 58455933 missense probably benign 0.04
R8259:Ranbp2 UTSW 10 58455933 missense probably benign 0.04
R8461:Ranbp2 UTSW 10 58476394 missense probably damaging 0.97
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCCAGTAGTGCAGATGC -3'
(R):5'- GAGAAGACGTTGACACTCCTC -3'

Sequencing Primer
(F):5'- CCAGTAGTGCAGATGCCAGAAAAG -3'
(R):5'- GAAGACGTTGACACTCCTCAAATTTC -3'
Posted On2019-05-15