Incidental Mutation 'R7083:Greb1'
ID549697
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7083 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16723314 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 253 (V253A)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably benign
Transcript: ENSMUST00000048064
AA Change: V253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: V253A

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
AA Change: V253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: V253A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162112
AA Change: V253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: V253A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGCCTTCCCAATGAAAG -3'
(R):5'- TCATTCTGCAGCCATTGGAG -3'

Sequencing Primer
(F):5'- TCCCAATGAAAGCCAACATGTACTTG -3'
(R):5'- GAAGAGCCAATTAGATTTCACACGTG -3'
Posted On2019-05-15