Incidental Mutation 'R7083:Adam21'
ID549700
Institutional Source Beutler Lab
Gene Symbol Adam21
Ensembl Gene ENSMUSG00000008438
Gene Namea disintegrin and metallopeptidase domain 21
SynonymsADAM31
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7083 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81558584-81568474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81560241 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 249 (M249K)
Ref Sequence ENSEMBL: ENSMUSP00000008582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008582
AA Change: M249K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: M249K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 164 5.1e-21 PFAM
Pfam:Reprolysin_4 212 389 2.5e-11 PFAM
Pfam:Reprolysin 212 402 7.3e-50 PFAM
Pfam:Reprolysin_5 214 400 5.8e-19 PFAM
Pfam:Reprolysin_2 233 393 1.3e-14 PFAM
Pfam:Reprolysin_3 236 356 6.5e-16 PFAM
DISIN 419 494 2.45e-37 SMART
ACR 495 631 6.49e-62 SMART
EGF 637 667 2.03e1 SMART
transmembrane domain 687 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btbd7 A G 12: 102,788,335 L724P probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Adam21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Adam21 APN 12 81559209 missense possibly damaging 0.61
IGL02311:Adam21 APN 12 81560892 missense probably benign 0.01
IGL03132:Adam21 APN 12 81560374 nonsense probably null
IGL03225:Adam21 APN 12 81559269 missense probably benign 0.00
R0305:Adam21 UTSW 12 81560285 missense possibly damaging 0.96
R0634:Adam21 UTSW 12 81560352 missense probably benign 0.01
R1415:Adam21 UTSW 12 81559547 nonsense probably null
R1961:Adam21 UTSW 12 81559508 nonsense probably null
R1996:Adam21 UTSW 12 81559602 missense possibly damaging 0.79
R2159:Adam21 UTSW 12 81560467 missense probably benign 0.17
R2215:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R3780:Adam21 UTSW 12 81559273 missense probably damaging 1.00
R3964:Adam21 UTSW 12 81560809 missense possibly damaging 0.46
R4356:Adam21 UTSW 12 81558820 missense probably damaging 0.99
R4503:Adam21 UTSW 12 81560898 missense probably benign
R4795:Adam21 UTSW 12 81560974 missense probably benign 0.06
R4925:Adam21 UTSW 12 81560389 missense probably benign
R4932:Adam21 UTSW 12 81558918 missense probably benign 0.14
R5110:Adam21 UTSW 12 81560215 missense probably benign 0.40
R5831:Adam21 UTSW 12 81559101 missense probably benign 0.06
R6289:Adam21 UTSW 12 81560706 missense probably damaging 1.00
R6500:Adam21 UTSW 12 81559606 missense probably benign 0.01
R7077:Adam21 UTSW 12 81559119 missense probably damaging 1.00
R7173:Adam21 UTSW 12 81559234 missense probably benign 0.24
R7176:Adam21 UTSW 12 81560248 missense possibly damaging 0.94
R7232:Adam21 UTSW 12 81560556 missense probably damaging 0.99
R7371:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R7486:Adam21 UTSW 12 81558883 missense probably benign 0.00
R7522:Adam21 UTSW 12 81558948 missense possibly damaging 0.78
R8040:Adam21 UTSW 12 81560437 missense not run
Z1088:Adam21 UTSW 12 81560686 missense probably damaging 1.00
Z1176:Adam21 UTSW 12 81559743 missense not run
Predicted Primers PCR Primer
(F):5'- GACGACATATTCCTGCAATGTAG -3'
(R):5'- ACCCTTTGGAGTTGAAGAGGC -3'

Sequencing Primer
(F):5'- TCCTGCAATGTAGGCTATACCAAG -3'
(R):5'- TTGAAGAGGCTAAGAAGTCAGCTATG -3'
Posted On2019-05-15