Incidental Mutation 'R7083:Btbd7'
ID 549701
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R7083 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102788335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 724 (L724P)
Ref Sequence ENSEMBL: ENSMUSP00000046951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: L724P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: L724P

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: L724P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,560,241 M249K possibly damaging Het
Arhgef38 T A 3: 133,132,436 Q613L unknown Het
Arpp21 A G 9: 112,183,544 V70A probably benign Het
AW551984 T C 9: 39,597,647 N327S probably damaging Het
Bnc1 T C 7: 81,973,310 K723R probably damaging Het
Btnl10 G T 11: 58,919,137 V35F probably damaging Het
Cd22 T A 7: 30,868,048 T704S probably damaging Het
Cd4 T G 6: 124,870,572 S210R probably benign Het
Cped1 A G 6: 22,123,580 Q444R probably benign Het
Dusp26 A G 8: 31,091,719 probably benign Het
Dync1i1 C T 6: 5,969,429 A418V probably damaging Het
Fibp A G 19: 5,463,631 D232G probably damaging Het
Frem2 T A 3: 53,537,493 T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr39 T A 1: 125,677,418 W28R probably damaging Het
Greb1 A G 12: 16,723,314 V253A probably benign Het
Hexim1 T G 11: 103,117,166 L82W possibly damaging Het
Hmga1 G T 17: 27,560,971 R49L possibly damaging Het
Itch A T 2: 155,210,444 N655Y probably damaging Het
Izumo2 A G 7: 44,710,333 E129G probably damaging Het
Klk1b24 G A 7: 44,191,801 C186Y probably damaging Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Lrmp A T 6: 145,169,783 N349I probably damaging Het
Lrrc37a T C 11: 103,503,340 I420V probably benign Het
Ltk A C 2: 119,752,074 C776G probably damaging Het
Mast4 A C 13: 102,737,715 L1715R probably damaging Het
Med28 T C 5: 45,523,536 probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,486 probably benign Het
Nckap1l C A 15: 103,482,124 T774K probably damaging Het
Nfkbiz T C 16: 55,818,300 K266E possibly damaging Het
Ntrk3 T A 7: 78,250,839 D584V probably damaging Het
Olfr107 T C 17: 37,406,172 V208A probably benign Het
Olfr1261 A G 2: 89,993,857 I155V probably benign Het
Olfr132 T A 17: 38,130,710 T161S probably benign Het
Olfr193 T C 16: 59,110,037 D191G probably damaging Het
Olfr733 G A 14: 50,299,279 T10I possibly damaging Het
Picalm T A 7: 90,176,768 I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prps1l3 A T 12: 57,239,248 I275L probably benign Het
Psg26 G A 7: 18,480,009 R243* probably null Het
Ranbp2 A G 10: 58,479,230 H1924R probably damaging Het
Rasef T C 4: 73,790,984 D4G probably benign Het
Rttn T C 18: 89,090,598 L1642P probably damaging Het
Shroom3 T C 5: 92,964,525 L1915P probably damaging Het
Slc26a10 A G 10: 127,177,168 V319A probably damaging Het
Slc4a10 A G 2: 62,234,495 N231S probably benign Het
Sox18 T C 2: 181,670,372 Q322R possibly damaging Het
Syde1 G T 10: 78,587,069 P490T probably benign Het
Syne2 A G 12: 75,943,888 I1881M probably damaging Het
Taf1c T C 8: 119,600,668 D387G probably damaging Het
Tenm4 T A 7: 96,895,349 Y2228N probably damaging Het
Tmem173 T C 18: 35,734,650 H331R probably damaging Het
Tubgcp5 C T 7: 55,800,695 Q185* probably null Het
Vmn2r44 T A 7: 8,378,370 I175F probably benign Het
Zdhhc7 C A 8: 120,085,427 C152F probably damaging Het
Zfp52 T A 17: 21,560,130 M80K possibly damaging Het
Zfp612 T C 8: 110,089,136 I325T probably damaging Het
Zmiz1 T G 14: 25,651,948 F597V probably damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTCTGCAGTGAAACAG -3'
(R):5'- GCATGGTGCACATATCTTAGAGG -3'

Sequencing Primer
(F):5'- CTGTTCTGCAGTGAAACAGTGAATG -3'
(R):5'- GTGCACATATCTTAGAGGTTGAAG -3'
Posted On 2019-05-15