Incidental Mutation 'R7083:Mast4'
ID 549702
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
MMRRC Submission 045177-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R7083 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 102868994-103471005 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 102874223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1715 (L1715R)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
AlphaFold Q811L6
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: L1538R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: L1538R

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: L1715R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: L1715R

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: L1523R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: L1523R

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A T 12: 81,607,015 (GRCm39) M249K possibly damaging Het
Arhgef38 T A 3: 132,838,197 (GRCm39) Q613L unknown Het
Arpp21 A G 9: 112,012,612 (GRCm39) V70A probably benign Het
AW551984 T C 9: 39,508,943 (GRCm39) N327S probably damaging Het
Bnc1 T C 7: 81,623,058 (GRCm39) K723R probably damaging Het
Btbd7 A G 12: 102,754,594 (GRCm39) L724P probably damaging Het
Btnl10 G T 11: 58,809,963 (GRCm39) V35F probably damaging Het
Cd22 T A 7: 30,567,473 (GRCm39) T704S probably damaging Het
Cd4 T G 6: 124,847,535 (GRCm39) S210R probably benign Het
Cped1 A G 6: 22,123,579 (GRCm39) Q444R probably benign Het
Dusp26 A G 8: 31,581,747 (GRCm39) probably benign Het
Dync1i1 C T 6: 5,969,429 (GRCm39) A418V probably damaging Het
Fibp A G 19: 5,513,659 (GRCm39) D232G probably damaging Het
Frem2 T A 3: 53,444,914 (GRCm39) T2406S probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gpr39 T A 1: 125,605,155 (GRCm39) W28R probably damaging Het
Greb1 A G 12: 16,773,315 (GRCm39) V253A probably benign Het
Hexim1 T G 11: 103,007,992 (GRCm39) L82W possibly damaging Het
Hmga1 G T 17: 27,779,945 (GRCm39) R49L possibly damaging Het
Irag2 A T 6: 145,115,509 (GRCm39) N349I probably damaging Het
Itch A T 2: 155,052,364 (GRCm39) N655Y probably damaging Het
Izumo2 A G 7: 44,359,757 (GRCm39) E129G probably damaging Het
Klk1b24 G A 7: 43,841,225 (GRCm39) C186Y probably damaging Het
Lnx1 G A 5: 74,788,846 (GRCm39) S31F possibly damaging Het
Lrrc37a T C 11: 103,394,166 (GRCm39) I420V probably benign Het
Ltk A C 2: 119,582,555 (GRCm39) C776G probably damaging Het
Med28 T C 5: 45,680,878 (GRCm39) probably null Het
Naf1 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 67,313,138 (GRCm39) probably benign Het
Nckap1l C A 15: 103,390,551 (GRCm39) T774K probably damaging Het
Nfkbiz T C 16: 55,638,663 (GRCm39) K266E possibly damaging Het
Ntrk3 T A 7: 77,900,587 (GRCm39) D584V probably damaging Het
Or1o1 T C 17: 37,717,063 (GRCm39) V208A probably benign Het
Or2h15 T A 17: 38,441,601 (GRCm39) T161S probably benign Het
Or4c126 A G 2: 89,824,201 (GRCm39) I155V probably benign Het
Or4n4b G A 14: 50,536,736 (GRCm39) T10I possibly damaging Het
Or5h25 T C 16: 58,930,400 (GRCm39) D191G probably damaging Het
Picalm T A 7: 89,825,976 (GRCm39) I376K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prps1l3 A T 12: 57,286,034 (GRCm39) I275L probably benign Het
Psg26 G A 7: 18,213,934 (GRCm39) R243* probably null Het
Ranbp2 A G 10: 58,315,052 (GRCm39) H1924R probably damaging Het
Rasef T C 4: 73,709,221 (GRCm39) D4G probably benign Het
Rttn T C 18: 89,108,722 (GRCm39) L1642P probably damaging Het
Shroom3 T C 5: 93,112,384 (GRCm39) L1915P probably damaging Het
Slc26a10 A G 10: 127,013,037 (GRCm39) V319A probably damaging Het
Slc4a10 A G 2: 62,064,839 (GRCm39) N231S probably benign Het
Sox18 T C 2: 181,312,165 (GRCm39) Q322R possibly damaging Het
Sting1 T C 18: 35,867,703 (GRCm39) H331R probably damaging Het
Syde1 G T 10: 78,422,903 (GRCm39) P490T probably benign Het
Syne2 A G 12: 75,990,662 (GRCm39) I1881M probably damaging Het
Taf1c T C 8: 120,327,407 (GRCm39) D387G probably damaging Het
Tenm4 T A 7: 96,544,556 (GRCm39) Y2228N probably damaging Het
Tubgcp5 C T 7: 55,450,443 (GRCm39) Q185* probably null Het
Vmn2r44 T A 7: 8,381,369 (GRCm39) I175F probably benign Het
Zdhhc7 C A 8: 120,812,166 (GRCm39) C152F probably damaging Het
Zfp52 T A 17: 21,780,392 (GRCm39) M80K possibly damaging Het
Zfp612 T C 8: 110,815,768 (GRCm39) I325T probably damaging Het
Zmiz1 T G 14: 25,652,372 (GRCm39) F597V probably damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102,907,275 (GRCm39) nonsense probably null
IGL00933:Mast4 APN 13 102,871,874 (GRCm39) missense probably damaging 0.97
IGL01113:Mast4 APN 13 102,910,744 (GRCm39) missense probably damaging 1.00
IGL01461:Mast4 APN 13 102,890,576 (GRCm39) missense probably damaging 1.00
IGL01569:Mast4 APN 13 102,897,523 (GRCm39) missense probably damaging 1.00
IGL01697:Mast4 APN 13 102,904,401 (GRCm39) missense probably damaging 1.00
IGL01725:Mast4 APN 13 102,887,020 (GRCm39) critical splice donor site probably null
IGL01734:Mast4 APN 13 102,874,123 (GRCm39) missense probably damaging 0.98
IGL01738:Mast4 APN 13 102,873,749 (GRCm39) missense probably damaging 1.00
IGL01739:Mast4 APN 13 102,910,781 (GRCm39) missense probably damaging 1.00
IGL02299:Mast4 APN 13 102,874,482 (GRCm39) missense probably benign 0.44
IGL02479:Mast4 APN 13 102,878,545 (GRCm39) missense probably damaging 1.00
IGL02485:Mast4 APN 13 102,872,004 (GRCm39) missense probably benign 0.02
IGL02528:Mast4 APN 13 102,990,331 (GRCm39) makesense probably null
IGL02850:Mast4 APN 13 102,890,740 (GRCm39) missense probably damaging 1.00
IGL02900:Mast4 APN 13 102,872,184 (GRCm39) missense probably benign
IGL03064:Mast4 APN 13 102,897,472 (GRCm39) nonsense probably null
IGL03124:Mast4 APN 13 102,874,753 (GRCm39) missense probably damaging 1.00
IGL03146:Mast4 APN 13 102,874,163 (GRCm39) missense probably benign 0.00
IGL03221:Mast4 APN 13 102,890,764 (GRCm39) missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102,887,905 (GRCm39) missense probably damaging 1.00
IGL03406:Mast4 APN 13 102,873,615 (GRCm39) missense possibly damaging 0.46
buck UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
doe UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
skinnybones UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
BB010:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
BB020:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102,871,370 (GRCm39) utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102,872,825 (GRCm39) small insertion probably benign
FR4340:Mast4 UTSW 13 102,871,365 (GRCm39) frame shift probably null
FR4548:Mast4 UTSW 13 102,872,826 (GRCm39) small insertion probably benign
FR4976:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
FR4976:Mast4 UTSW 13 102,872,820 (GRCm39) small insertion probably benign
NA:Mast4 UTSW 13 102,878,565 (GRCm39) missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
R0009:Mast4 UTSW 13 102,878,566 (GRCm39) missense probably damaging 1.00
R0063:Mast4 UTSW 13 103,470,723 (GRCm39) start gained probably benign
R0242:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R0310:Mast4 UTSW 13 102,890,669 (GRCm39) missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102,871,781 (GRCm39) missense probably damaging 1.00
R0454:Mast4 UTSW 13 102,888,068 (GRCm39) missense probably damaging 1.00
R0646:Mast4 UTSW 13 102,895,252 (GRCm39) splice site probably benign
R0744:Mast4 UTSW 13 102,873,895 (GRCm39) missense probably damaging 0.98
R0883:Mast4 UTSW 13 102,990,408 (GRCm39) missense probably damaging 1.00
R0905:Mast4 UTSW 13 102,907,292 (GRCm39) missense probably damaging 0.99
R1023:Mast4 UTSW 13 102,872,004 (GRCm39) missense probably benign 0.02
R1281:Mast4 UTSW 13 102,887,086 (GRCm39) missense probably damaging 1.00
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102,909,027 (GRCm39) missense probably damaging 1.00
R1572:Mast4 UTSW 13 102,873,431 (GRCm39) missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102,875,771 (GRCm39) missense probably damaging 1.00
R1865:Mast4 UTSW 13 102,930,625 (GRCm39) missense probably damaging 1.00
R2050:Mast4 UTSW 13 102,887,917 (GRCm39) missense probably damaging 1.00
R2060:Mast4 UTSW 13 102,875,354 (GRCm39) missense probably damaging 1.00
R2062:Mast4 UTSW 13 102,895,601 (GRCm39) missense probably benign 0.18
R2106:Mast4 UTSW 13 102,887,054 (GRCm39) missense probably damaging 1.00
R2118:Mast4 UTSW 13 102,890,713 (GRCm39) missense probably damaging 1.00
R2143:Mast4 UTSW 13 102,871,983 (GRCm39) missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102,872,259 (GRCm39) missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102,934,715 (GRCm39) splice site probably benign
R2370:Mast4 UTSW 13 102,910,695 (GRCm39) missense probably damaging 1.00
R2504:Mast4 UTSW 13 102,875,147 (GRCm39) missense probably damaging 0.96
R2509:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R2842:Mast4 UTSW 13 102,872,939 (GRCm39) missense probably benign 0.01
R3087:Mast4 UTSW 13 102,990,434 (GRCm39) splice site probably benign
R3434:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3435:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3763:Mast4 UTSW 13 102,923,927 (GRCm39) missense probably damaging 1.00
R3826:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3829:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3830:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3913:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R3914:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4021:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4022:Mast4 UTSW 13 102,990,377 (GRCm39) missense probably damaging 1.00
R4022:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4210:Mast4 UTSW 13 102,875,713 (GRCm39) missense probably damaging 1.00
R4342:Mast4 UTSW 13 102,910,756 (GRCm39) missense probably damaging 1.00
R4580:Mast4 UTSW 13 102,873,766 (GRCm39) nonsense probably null
R4627:Mast4 UTSW 13 103,470,529 (GRCm39) missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103,470,627 (GRCm39) missense probably benign 0.01
R4732:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4733:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4833:Mast4 UTSW 13 102,910,692 (GRCm39) critical splice donor site probably null
R4995:Mast4 UTSW 13 103,042,262 (GRCm39) intron probably benign
R5059:Mast4 UTSW 13 102,887,071 (GRCm39) missense probably damaging 1.00
R5073:Mast4 UTSW 13 102,875,391 (GRCm39) nonsense probably null
R5101:Mast4 UTSW 13 102,872,864 (GRCm39) missense probably benign 0.01
R5526:Mast4 UTSW 13 102,890,723 (GRCm39) missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102,873,987 (GRCm39) missense probably damaging 1.00
R5673:Mast4 UTSW 13 102,930,580 (GRCm39) missense probably damaging 1.00
R5694:Mast4 UTSW 13 102,910,701 (GRCm39) nonsense probably null
R5906:Mast4 UTSW 13 102,872,252 (GRCm39) missense probably benign 0.31
R5908:Mast4 UTSW 13 102,874,764 (GRCm39) missense probably damaging 1.00
R5947:Mast4 UTSW 13 102,872,148 (GRCm39) missense probably benign
R5987:Mast4 UTSW 13 102,895,242 (GRCm39) missense probably damaging 1.00
R6143:Mast4 UTSW 13 102,990,391 (GRCm39) missense probably damaging 1.00
R6154:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6169:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6239:Mast4 UTSW 13 102,872,717 (GRCm39) missense probably benign 0.01
R6327:Mast4 UTSW 13 102,897,890 (GRCm39) missense probably damaging 1.00
R6356:Mast4 UTSW 13 102,872,493 (GRCm39) missense possibly damaging 0.80
R6432:Mast4 UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
R6667:Mast4 UTSW 13 102,874,004 (GRCm39) missense probably damaging 1.00
R6941:Mast4 UTSW 13 102,941,222 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,934,586 (GRCm39) missense probably damaging 1.00
R6970:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6980:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6991:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6992:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6993:Mast4 UTSW 13 102,872,482 (GRCm39) missense probably benign 0.28
R6993:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R7241:Mast4 UTSW 13 103,470,508 (GRCm39) missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102,874,986 (GRCm39) missense probably damaging 1.00
R7246:Mast4 UTSW 13 102,930,511 (GRCm39) missense probably damaging 1.00
R7332:Mast4 UTSW 13 102,887,932 (GRCm39) missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
R7514:Mast4 UTSW 13 102,923,934 (GRCm39) nonsense probably null
R7697:Mast4 UTSW 13 102,875,711 (GRCm39) missense probably damaging 1.00
R7820:Mast4 UTSW 13 102,890,596 (GRCm39) missense probably damaging 1.00
R7874:Mast4 UTSW 13 102,875,783 (GRCm39) missense probably damaging 1.00
R7933:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
R8042:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.96
R8060:Mast4 UTSW 13 102,874,184 (GRCm39) missense possibly damaging 0.89
R8172:Mast4 UTSW 13 103,089,633 (GRCm39) critical splice donor site probably null
R8206:Mast4 UTSW 13 102,872,247 (GRCm39) missense probably damaging 1.00
R8248:Mast4 UTSW 13 102,875,229 (GRCm39) missense probably damaging 1.00
R8283:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R8346:Mast4 UTSW 13 102,887,986 (GRCm39) missense probably damaging 0.99
R8434:Mast4 UTSW 13 102,897,900 (GRCm39) missense probably damaging 1.00
R8796:Mast4 UTSW 13 102,919,899 (GRCm39) missense probably benign 0.07
R8850:Mast4 UTSW 13 102,895,174 (GRCm39) missense probably damaging 1.00
R9012:Mast4 UTSW 13 102,934,606 (GRCm39) missense probably benign 0.05
R9375:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.99
R9389:Mast4 UTSW 13 103,470,438 (GRCm39) missense probably benign 0.00
R9404:Mast4 UTSW 13 102,887,933 (GRCm39) missense probably damaging 1.00
R9520:Mast4 UTSW 13 102,925,532 (GRCm39) missense probably damaging 1.00
R9525:Mast4 UTSW 13 102,872,944 (GRCm39) missense probably benign 0.00
R9526:Mast4 UTSW 13 102,873,593 (GRCm39) missense probably benign 0.00
R9709:Mast4 UTSW 13 102,910,711 (GRCm39) missense probably damaging 1.00
R9790:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
R9791:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
RF005:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF015:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
RF019:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF037:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF039:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF040:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
Z1088:Mast4 UTSW 13 102,875,027 (GRCm39) missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102,874,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGACCTGCCCTCTAGC -3'
(R):5'- TTGAATACTCGGAGAAGGCC -3'

Sequencing Primer
(F):5'- CCTCTAGCTTATACTCGGAGGG -3'
(R):5'- CTCTCAGGCCAAAGAGCTCCTTC -3'
Posted On 2019-05-15