Mutagenetix > Incidental Mutation

Incidental Mutation 'R0614:Naip1'

54972

Institutional Source

Beutler Lab

Gene Symbol

Naip1

Ensembl Gene

ENSMUSG00000021640

Gene Name

NLR family, apoptosis inhibitory protein 1

Synonyms

Birc1a, D13Lsd1, Naip

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0614 (G1)

Quality Score

185

Status

Not validated

Chromosome

Chromosomal Location

100407764-100452869 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 100444200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 180 (V180L)

Ref Sequence

ENSEMBL: ENSMUSP00000152583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]

AlphaFold

Q9QWK5

Predicted Effect

probably benign
Transcript: ENSMUST00000022142
AA Change: V180L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: V180L

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.18e-20	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	7.82e-26	SMART
AAA	462	603	1.14e-2	SMART
low complexity region	908	919	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221727
AA Change: V180L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000221943
AA Change: V180L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000222155
AA Change: V180L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Cep250	C	T	2: 155,970,097	Q438*	probably null	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Naip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01115:Naip1	APN	13	100443720	critical splice acceptor site	probably null
IGL01145:Naip1	APN	13	100409121	missense	probably benign	0.00
IGL01356:Naip1	APN	13	100423214	missense	probably damaging	0.99
IGL01414:Naip1	APN	13	100409173	critical splice acceptor site	probably null
IGL01505:Naip1	APN	13	100425933	missense	probably damaging	1.00
IGL01573:Naip1	APN	13	100427382	missense	probably benign	0.03
IGL01931:Naip1	APN	13	100409032	nonsense	probably null
IGL02043:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02097:Naip1	APN	13	100425588	missense	probably benign	0.03
IGL02331:Naip1	APN	13	100426796	missense	probably benign	0.03
IGL02627:Naip1	APN	13	100425648	missense	possibly damaging	0.68
IGL02675:Naip1	APN	13	100409118	missense	probably benign
IGL02801:Naip1	APN	13	100444368	missense	probably damaging	1.00
IGL02851:Naip1	APN	13	100433262	missense	probably damaging	1.00
IGL03038:Naip1	APN	13	100437333	nonsense	probably null
IGL03399:Naip1	APN	13	100408918	missense	probably damaging	1.00
FR4340:Naip1	UTSW	13	100423076	missense	probably benign
FR4342:Naip1	UTSW	13	100425471	missense	probably benign	0.00
R0051:Naip1	UTSW	13	100411001	missense	probably damaging	0.96
R0095:Naip1	UTSW	13	100423083	missense	probably benign	0.24
R0147:Naip1	UTSW	13	100426910	missense	possibly damaging	0.67
R0375:Naip1	UTSW	13	100409148	missense	probably benign	0.21
R0442:Naip1	UTSW	13	100444516	missense	probably benign	0.00
R0455:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0491:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R0785:Naip1	UTSW	13	100423076	missense	probably benign
R0785:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R0787:Naip1	UTSW	13	100426096	missense	probably benign	0.22
R1081:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R1177:Naip1	UTSW	13	100427064	missense	possibly damaging	0.91
R1476:Naip1	UTSW	13	100426870	missense	probably benign	0.35
R1672:Naip1	UTSW	13	100423149	missense	probably benign	0.00
R1809:Naip1	UTSW	13	100426239	missense	probably benign
R2057:Naip1	UTSW	13	100425573	missense	probably damaging	0.96
R2182:Naip1	UTSW	13	100413680	missense	probably benign	0.01
R2395:Naip1	UTSW	13	100423106	missense	possibly damaging	0.83
R2518:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R3033:Naip1	UTSW	13	100432458	missense	probably benign	0.01
R3122:Naip1	UTSW	13	100408995	missense	probably damaging	1.00
R3439:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R4167:Naip1	UTSW	13	100444286	missense	probably benign	0.04
R4179:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R4212:Naip1	UTSW	13	100426875	splice site	probably null
R4639:Naip1	UTSW	13	100444283	missense	probably benign	0.31
R4674:Naip1	UTSW	13	100444174	missense	probably damaging	1.00
R4736:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4740:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R4778:Naip1	UTSW	13	100426648	missense	probably damaging	1.00
R4806:Naip1	UTSW	13	100425621	missense	probably benign	0.00
R4855:Naip1	UTSW	13	100423220	splice site	probably null
R5740:Naip1	UTSW	13	100432501	critical splice acceptor site	probably null
R5797:Naip1	UTSW	13	100444526	missense	possibly damaging	0.47
R5806:Naip1	UTSW	13	100444735	start codon destroyed	probably null	1.00
R5895:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R5896:Naip1	UTSW	13	100423128	missense	probably benign	0.00
R6023:Naip1	UTSW	13	100426186	missense	probably benign	0.00
R6109:Naip1	UTSW	13	100427182	missense	probably damaging	1.00
R6117:Naip1	UTSW	13	100444737	start codon destroyed	probably damaging	0.99
R6133:Naip1	UTSW	13	100444643	missense	probably benign	0.10
R6241:Naip1	UTSW	13	100425661	missense	probably damaging	0.99
R6335:Naip1	UTSW	13	100426552	missense	probably damaging	1.00
R6404:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R6475:Naip1	UTSW	13	100409088	missense	probably damaging	1.00
R6508:Naip1	UTSW	13	100436465	missense	probably damaging	1.00
R6580:Naip1	UTSW	13	100444649	missense	probably damaging	0.99
R6600:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6600:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6603:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R6603:Naip1	UTSW	13	100423158	missense	probably benign	0.00
R6633:Naip1	UTSW	13	100423076	missense	probably benign
R6633:Naip1	UTSW	13	100423085	missense	probably benign	0.00
R6720:Naip1	UTSW	13	100423077	missense	probably benign	0.00
R6805:Naip1	UTSW	13	100427341	missense	probably benign	0.04
R7043:Naip1	UTSW	13	100426914	missense	probably damaging	1.00
R7615:Naip1	UTSW	13	100425776	missense	probably benign	0.00
R7797:Naip1	UTSW	13	100444478	missense	probably damaging	1.00
R7820:Naip1	UTSW	13	100423070	missense	probably benign	0.21
R7842:Naip1	UTSW	13	100426998	missense	probably damaging	1.00
R8117:Naip1	UTSW	13	100427001	missense	possibly damaging	0.67
R8132:Naip1	UTSW	13	100437375	missense	possibly damaging	0.84
R8177:Naip1	UTSW	13	100427403	missense	probably benign	0.00
R8203:Naip1	UTSW	13	100425820	missense	probably benign	0.02
R8283:Naip1	UTSW	13	100427187	missense	probably damaging	1.00
R8319:Naip1	UTSW	13	100429213	missense	probably benign	0.13
R8377:Naip1	UTSW	13	100425866	missense	possibly damaging	0.53
R8864:Naip1	UTSW	13	100426320	missense	possibly damaging	0.55
R8871:Naip1	UTSW	13	100443638	missense	probably damaging	1.00
R8987:Naip1	UTSW	13	100426926	missense	probably damaging	1.00
R9079:Naip1	UTSW	13	100423219	missense	probably benign	0.00
R9275:Naip1	UTSW	13	100426176	missense	probably damaging	0.99
R9354:Naip1	UTSW	13	100427486	missense	probably benign	0.31
R9524:Naip1	UTSW	13	100426593	missense	probably benign	0.06
RF007:Naip1	UTSW	13	100426134	missense	probably benign	0.03
X0066:Naip1	UTSW	13	100437322	missense	probably damaging	1.00
Y4335:Naip1	UTSW	13	100425522	missense	probably benign	0.00
Y4336:Naip1	UTSW	13	100425522	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGCCCACTGCTGGTACATTTAAGG -3'
(R):5'- ACGTTCAGATCATGGACGCCACAG -3'

Sequencing Primer
(F):5'- CAGGCAAATACATGGCTGC -3'
(R):5'- TCTTTGGCAATAGCCTCAGGAAG -3'

Posted On

2013-07-11