Incidental Mutation 'R0614:Ap1g2'
ID 54973
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Name adaptor protein complex AP-1, gamma 2 subunit
Synonyms gamma 2-adaptin, Adtg2
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R0614 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55098575-55106593 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55099773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 702 (V702I)
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036041] [ENSMUST00000050575] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285] [ENSMUST00000183822] [ENSMUST00000185121]
AlphaFold O88512
Predicted Effect probably benign
Transcript: ENSMUST00000036041
AA Change: V702I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701
AA Change: V702I

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050575
SMART Domains Protein: ENSMUSP00000056026
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
CYTH 5 200 1.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139536
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153702
Predicted Effect probably benign
Transcript: ENSMUST00000170285
AA Change: V702I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701
AA Change: V702I

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55105114 missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55102402 missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55100647 splice site probably null
IGL02967:Ap1g2 APN 14 55105022 splice site probably benign
IGL03030:Ap1g2 APN 14 55106047 missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55103036 missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55100530 missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55104876 missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55101692 splice site probably benign
R0762:Ap1g2 UTSW 14 55100411 splice site probably benign
R1561:Ap1g2 UTSW 14 55104887 missense probably damaging 1.00
R1889:Ap1g2 UTSW 14 55101429 missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55099772 missense possibly damaging 0.80
R1997:Ap1g2 UTSW 14 55102378 missense probably benign 0.00
R2169:Ap1g2 UTSW 14 55099340 critical splice acceptor site probably null
R3157:Ap1g2 UTSW 14 55099274 missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55100573 splice site probably benign
R3850:Ap1g2 UTSW 14 55104906 missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55104365 missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55105026 critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55099076 missense probably benign
R5880:Ap1g2 UTSW 14 55102700 missense probably damaging 1.00
R6243:Ap1g2 UTSW 14 55099073 missense probably benign
R6964:Ap1g2 UTSW 14 55099265 missense possibly damaging 0.85
R7039:Ap1g2 UTSW 14 55102654 nonsense probably null
R7180:Ap1g2 UTSW 14 55104451 missense probably damaging 1.00
R7563:Ap1g2 UTSW 14 55099749 missense probably damaging 1.00
R7818:Ap1g2 UTSW 14 55099724 missense probably benign 0.44
R7854:Ap1g2 UTSW 14 55105933 missense probably damaging 1.00
R9060:Ap1g2 UTSW 14 55100430 missense probably benign 0.00
R9171:Ap1g2 UTSW 14 55099124 missense probably benign 0.05
R9276:Ap1g2 UTSW 14 55102361 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATTCCCTGGCTACCTCTGAATGC -3'
(R):5'- CAGCCCAAGCCTTAGCTTGTCTAC -3'

Sequencing Primer
(F):5'- caaagtcactatgttaaggcagg -3'
(R):5'- TATCATTAGATCCGGGGCAGC -3'
Posted On 2013-07-11