Incidental Mutation 'R7084:Padi6'
ID 549737
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7084 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 140741558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 5 (K5*)
Ref Sequence ENSEMBL: ENSMUSP00000123490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026381] [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably benign
Transcript: ENSMUST00000026381
SMART Domains Protein: ENSMUSP00000026381
Gene: ENSMUSG00000025330

DomainStartEndE-ValueType
Pfam:PAD_N 1 111 2.3e-38 PFAM
Pfam:PAD_M 113 273 2.4e-63 PFAM
Pfam:PAD 283 663 2.4e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038749
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130267
AA Change: K5*
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935
AA Change: K5*

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fbxw22 A G 9: 109,404,223 L14P probably damaging Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mast3 T C 8: 70,779,473 I1287V probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mme T C 3: 63,328,217 Y195H probably damaging Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Myo1e A G 9: 70,337,801 I394V probably damaging Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Otog T A 7: 46,298,566 C145* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGTCGTTTGCCCTGGC -3'
(R):5'- CCCACTGTGGATGAAGACAAGG -3'

Sequencing Primer
(F):5'- TTGCCCTGGCTTGGAGC -3'
(R):5'- CTGTGGATGAAGACAAGGTGAGC -3'
Posted On 2019-05-15