Incidental Mutation 'R7084:Slc8a2'
ID 549750
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 2
Synonyms Ncx2
MMRRC Submission 045178-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R7084 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 15863751-15894988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15878963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 483 (L483Q)
Ref Sequence ENSEMBL: ENSMUSP00000147497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
AlphaFold Q8K596
Predicted Effect probably benign
Transcript: ENSMUST00000168693
AA Change: L483Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: L483Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211649
AA Change: L483Q

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,624,721 (GRCm39) D8E unknown Het
Abca5 T A 11: 110,192,371 (GRCm39) I714L probably benign Het
Abce1 T A 8: 80,426,043 (GRCm39) S245C probably benign Het
Abcg1 T A 17: 31,325,105 (GRCm39) D310E probably benign Het
Adhfe1 T A 1: 9,637,030 (GRCm39) I394N probably benign Het
Apob A T 12: 8,059,591 (GRCm39) D2691V probably benign Het
Arhgap18 A G 10: 26,748,734 (GRCm39) T340A possibly damaging Het
Arsb A T 13: 94,077,124 (GRCm39) Q497L probably benign Het
Asic5 T C 3: 81,919,318 (GRCm39) I354T probably benign Het
Atp6v0a1 T C 11: 100,924,868 (GRCm39) C318R probably damaging Het
Cftr T C 6: 18,226,137 (GRCm39) Y362H probably benign Het
Crip3 T C 17: 46,741,716 (GRCm39) Y113H probably benign Het
Dcaf4 AT A 12: 83,584,571 (GRCm39) probably null Het
Dock10 T A 1: 80,481,573 (GRCm39) I475F Het
Dqx1 T A 6: 83,043,436 (GRCm39) Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 (GRCm39) Q2437K possibly damaging Het
Ednra A T 8: 78,391,734 (GRCm39) C385* probably null Het
Fam216a G A 5: 122,507,623 (GRCm39) T68I probably benign Het
Fbxw22 A G 9: 109,233,291 (GRCm39) L14P probably damaging Het
Fem1al G T 11: 29,775,009 (GRCm39) H149Q probably damaging Het
Fkbp10 A G 11: 100,312,129 (GRCm39) I230V possibly damaging Het
Ggn C A 7: 28,872,423 (GRCm39) A637E probably damaging Het
Hcrtr2 T C 9: 76,137,942 (GRCm39) D391G probably benign Het
Heatr5b A T 17: 79,117,992 (GRCm39) V817D possibly damaging Het
Il1f10 G A 2: 24,183,682 (GRCm39) W120* probably null Het
Irf5 C A 6: 29,535,876 (GRCm39) R297S probably damaging Het
Jak2 A G 19: 29,263,798 (GRCm39) T438A possibly damaging Het
Jsrp1 T C 10: 80,644,410 (GRCm39) D332G possibly damaging Het
Kank4 A T 4: 98,659,582 (GRCm39) V832D probably damaging Het
Kcnip3 C T 2: 127,352,856 (GRCm39) S25N probably benign Het
Klk1b16 C T 7: 43,788,910 (GRCm39) H48Y probably benign Het
Klrh1 C A 6: 129,743,673 (GRCm39) A204S possibly damaging Het
Krtap5-4 G A 7: 141,857,609 (GRCm39) C93Y unknown Het
Lacc1 T A 14: 77,267,096 (GRCm39) Q389L probably benign Het
Lin9 C A 1: 180,515,661 (GRCm39) T477K probably benign Het
Lpar2 A T 8: 70,276,256 (GRCm39) N15I probably damaging Het
Ltbp2 C A 12: 84,915,459 (GRCm39) C200F probably damaging Het
Mall G T 2: 127,550,793 (GRCm39) H122Q probably benign Het
Mast3 T C 8: 71,232,117 (GRCm39) I1287V probably benign Het
Mindy4 T C 6: 55,255,220 (GRCm39) I566T probably benign Het
Mme T C 3: 63,235,638 (GRCm39) Y195H probably damaging Het
Mpzl1 T C 1: 165,432,267 (GRCm39) T173A probably benign Het
Mri1 G T 8: 84,977,708 (GRCm39) T209N Het
Myo1e A G 9: 70,245,083 (GRCm39) I394V probably damaging Het
Nat14 T C 7: 4,927,329 (GRCm39) V167A possibly damaging Het
Nfasc A G 1: 132,498,247 (GRCm39) Y1212H unknown Het
Nsun7 T A 5: 66,452,764 (GRCm39) L493Q probably damaging Het
Obsl1 A T 1: 75,464,394 (GRCm39) S1637R probably benign Het
Ocstamp A T 2: 165,239,957 (GRCm39) Y76* probably null Het
Or5b95 A C 19: 12,658,198 (GRCm39) H242P probably damaging Het
Or6c2b T A 10: 128,947,416 (GRCm39) K293* probably null Het
Or8b52 G A 9: 38,576,565 (GRCm39) R192C probably benign Het
Otog T A 7: 45,947,990 (GRCm39) C145* probably null Het
Padi6 T A 4: 140,468,869 (GRCm39) K5* probably null Het
Pcdha5 T A 18: 37,094,615 (GRCm39) S375T probably benign Het
Pde10a C T 17: 9,159,994 (GRCm39) P140S probably benign Het
Pgbd1 C G 13: 21,607,300 (GRCm39) C298S possibly damaging Het
Plch2 C T 4: 155,071,448 (GRCm39) G977D probably benign Het
Pou2f3 T C 9: 43,040,188 (GRCm39) T367A probably damaging Het
Ppm1j T A 3: 104,692,276 (GRCm39) Y352N probably damaging Het
Prkag2 T C 5: 25,226,967 (GRCm39) T97A probably benign Het
Rpl36a-ps1 T A 14: 99,231,660 (GRCm39) Y26F probably benign Het
Sctr A T 1: 119,991,001 (GRCm39) N445Y possibly damaging Het
Serping1 C T 2: 84,603,835 (GRCm39) V69I probably benign Het
Spag17 T C 3: 99,846,586 (GRCm39) F37L probably benign Het
Srrm2 T A 17: 24,039,290 (GRCm39) M1978K probably damaging Het
Tcp11 T C 17: 28,285,995 (GRCm39) Q540R probably benign Het
Thnsl1 G T 2: 21,217,141 (GRCm39) R298S possibly damaging Het
Tigd5 T A 15: 75,782,230 (GRCm39) Y197* probably null Het
Tmprss11g A T 5: 86,640,059 (GRCm39) L203Q probably damaging Het
Trim35 T A 14: 66,546,271 (GRCm39) V346E probably damaging Het
Ttn T C 2: 76,598,708 (GRCm39) I19402V possibly damaging Het
Ttn C T 2: 76,749,689 (GRCm39) E3787K probably benign Het
Tut1 G A 19: 8,942,778 (GRCm39) V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 (GRCm39) I18V probably benign Het
Zbbx T C 3: 75,046,853 (GRCm39) N22S possibly damaging Het
Zfp169 A C 13: 48,652,339 (GRCm39) M26R probably benign Het
Zfp180 T A 7: 23,804,686 (GRCm39) H368Q probably damaging Het
Zfp638 T A 6: 83,930,108 (GRCm39) S770T possibly damaging Het
Znrf1 T C 8: 112,263,774 (GRCm39) M1T probably null Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 15,892,818 (GRCm39) missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 15,891,081 (GRCm39) missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 15,878,954 (GRCm39) missense possibly damaging 0.91
PIT4402001:Slc8a2 UTSW 7 15,868,419 (GRCm39) missense probably damaging 1.00
PIT4515001:Slc8a2 UTSW 7 15,874,504 (GRCm39) missense possibly damaging 0.69
R0281:Slc8a2 UTSW 7 15,874,914 (GRCm39) missense probably benign
R0513:Slc8a2 UTSW 7 15,891,264 (GRCm39) missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 15,875,039 (GRCm39) missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 15,875,039 (GRCm39) missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 15,878,887 (GRCm39) missense probably benign 0.04
R1167:Slc8a2 UTSW 7 15,891,312 (GRCm39) missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 15,874,522 (GRCm39) missense probably benign 0.00
R1655:Slc8a2 UTSW 7 15,875,060 (GRCm39) missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 15,886,845 (GRCm39) missense probably benign 0.11
R1919:Slc8a2 UTSW 7 15,886,845 (GRCm39) missense probably benign 0.11
R2051:Slc8a2 UTSW 7 15,874,940 (GRCm39) missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 15,868,440 (GRCm39) missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 15,874,417 (GRCm39) splice site probably null
R2149:Slc8a2 UTSW 7 15,893,089 (GRCm39) missense probably damaging 1.00
R3437:Slc8a2 UTSW 7 15,892,810 (GRCm39) missense probably damaging 1.00
R3618:Slc8a2 UTSW 7 15,886,824 (GRCm39) missense possibly damaging 0.48
R4645:Slc8a2 UTSW 7 15,868,164 (GRCm39) missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 15,868,233 (GRCm39) missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 15,868,100 (GRCm39) nonsense probably null
R5071:Slc8a2 UTSW 7 15,884,508 (GRCm39) missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 15,884,508 (GRCm39) missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 15,884,508 (GRCm39) missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 15,879,101 (GRCm39) missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 15,891,228 (GRCm39) missense probably damaging 1.00
R5839:Slc8a2 UTSW 7 15,868,412 (GRCm39) missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 15,879,209 (GRCm39) missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 15,879,259 (GRCm39) missense possibly damaging 0.94
R6363:Slc8a2 UTSW 7 15,867,970 (GRCm39) missense probably benign 0.00
R6881:Slc8a2 UTSW 7 15,891,282 (GRCm39) missense probably damaging 1.00
R7211:Slc8a2 UTSW 7 15,874,538 (GRCm39) missense possibly damaging 0.87
R7227:Slc8a2 UTSW 7 15,878,906 (GRCm39) missense possibly damaging 0.73
R7278:Slc8a2 UTSW 7 15,875,077 (GRCm39) missense probably damaging 1.00
R7380:Slc8a2 UTSW 7 15,868,278 (GRCm39) missense probably damaging 1.00
R8239:Slc8a2 UTSW 7 15,879,230 (GRCm39) missense probably benign 0.00
R8698:Slc8a2 UTSW 7 15,891,132 (GRCm39) missense probably damaging 1.00
R8926:Slc8a2 UTSW 7 15,868,194 (GRCm39) missense probably damaging 1.00
R9249:Slc8a2 UTSW 7 15,891,156 (GRCm39) missense probably damaging 1.00
R9483:Slc8a2 UTSW 7 15,886,780 (GRCm39) missense possibly damaging 0.95
R9530:Slc8a2 UTSW 7 15,879,269 (GRCm39) missense probably null 0.86
R9778:Slc8a2 UTSW 7 15,887,124 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a2 UTSW 7 15,874,912 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCCACTTCAGCAGATACTAAGGG -3'
(R):5'- TCCTCGTAATGTACACCACCG -3'

Sequencing Primer
(F):5'- ACTGGCTGCTCTTCCAAAAGG -3'
(R):5'- GCGCACATCCACAGTGC -3'
Posted On 2019-05-15