Incidental Mutation 'R7084:Dync2h1'
ID 549762
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms DHC1b, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, 4432416O06Rik, DHC2, D330044F14Rik
MMRRC Submission 045178-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7084 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 6928550-7177619 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 7113214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 2437 (Q2437K)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193] [ENSMUST00000216097]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048417
AA Change: Q2437K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: Q2437K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140466
AA Change: Q2437K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: Q2437K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147193
AA Change: Q2437K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: Q2437K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000216097
AA Change: Q204K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,624,721 (GRCm39) D8E unknown Het
Abca5 T A 11: 110,192,371 (GRCm39) I714L probably benign Het
Abce1 T A 8: 80,426,043 (GRCm39) S245C probably benign Het
Abcg1 T A 17: 31,325,105 (GRCm39) D310E probably benign Het
Adhfe1 T A 1: 9,637,030 (GRCm39) I394N probably benign Het
Apob A T 12: 8,059,591 (GRCm39) D2691V probably benign Het
Arhgap18 A G 10: 26,748,734 (GRCm39) T340A possibly damaging Het
Arsb A T 13: 94,077,124 (GRCm39) Q497L probably benign Het
Asic5 T C 3: 81,919,318 (GRCm39) I354T probably benign Het
Atp6v0a1 T C 11: 100,924,868 (GRCm39) C318R probably damaging Het
Cftr T C 6: 18,226,137 (GRCm39) Y362H probably benign Het
Crip3 T C 17: 46,741,716 (GRCm39) Y113H probably benign Het
Dcaf4 AT A 12: 83,584,571 (GRCm39) probably null Het
Dock10 T A 1: 80,481,573 (GRCm39) I475F Het
Dqx1 T A 6: 83,043,436 (GRCm39) Y674N probably damaging Het
Ednra A T 8: 78,391,734 (GRCm39) C385* probably null Het
Fam216a G A 5: 122,507,623 (GRCm39) T68I probably benign Het
Fbxw22 A G 9: 109,233,291 (GRCm39) L14P probably damaging Het
Fem1al G T 11: 29,775,009 (GRCm39) H149Q probably damaging Het
Fkbp10 A G 11: 100,312,129 (GRCm39) I230V possibly damaging Het
Ggn C A 7: 28,872,423 (GRCm39) A637E probably damaging Het
Hcrtr2 T C 9: 76,137,942 (GRCm39) D391G probably benign Het
Heatr5b A T 17: 79,117,992 (GRCm39) V817D possibly damaging Het
Il1f10 G A 2: 24,183,682 (GRCm39) W120* probably null Het
Irf5 C A 6: 29,535,876 (GRCm39) R297S probably damaging Het
Jak2 A G 19: 29,263,798 (GRCm39) T438A possibly damaging Het
Jsrp1 T C 10: 80,644,410 (GRCm39) D332G possibly damaging Het
Kank4 A T 4: 98,659,582 (GRCm39) V832D probably damaging Het
Kcnip3 C T 2: 127,352,856 (GRCm39) S25N probably benign Het
Klk1b16 C T 7: 43,788,910 (GRCm39) H48Y probably benign Het
Klrh1 C A 6: 129,743,673 (GRCm39) A204S possibly damaging Het
Krtap5-4 G A 7: 141,857,609 (GRCm39) C93Y unknown Het
Lacc1 T A 14: 77,267,096 (GRCm39) Q389L probably benign Het
Lin9 C A 1: 180,515,661 (GRCm39) T477K probably benign Het
Lpar2 A T 8: 70,276,256 (GRCm39) N15I probably damaging Het
Ltbp2 C A 12: 84,915,459 (GRCm39) C200F probably damaging Het
Mall G T 2: 127,550,793 (GRCm39) H122Q probably benign Het
Mast3 T C 8: 71,232,117 (GRCm39) I1287V probably benign Het
Mindy4 T C 6: 55,255,220 (GRCm39) I566T probably benign Het
Mme T C 3: 63,235,638 (GRCm39) Y195H probably damaging Het
Mpzl1 T C 1: 165,432,267 (GRCm39) T173A probably benign Het
Mri1 G T 8: 84,977,708 (GRCm39) T209N Het
Myo1e A G 9: 70,245,083 (GRCm39) I394V probably damaging Het
Nat14 T C 7: 4,927,329 (GRCm39) V167A possibly damaging Het
Nfasc A G 1: 132,498,247 (GRCm39) Y1212H unknown Het
Nsun7 T A 5: 66,452,764 (GRCm39) L493Q probably damaging Het
Obsl1 A T 1: 75,464,394 (GRCm39) S1637R probably benign Het
Ocstamp A T 2: 165,239,957 (GRCm39) Y76* probably null Het
Or5b95 A C 19: 12,658,198 (GRCm39) H242P probably damaging Het
Or6c2b T A 10: 128,947,416 (GRCm39) K293* probably null Het
Or8b52 G A 9: 38,576,565 (GRCm39) R192C probably benign Het
Otog T A 7: 45,947,990 (GRCm39) C145* probably null Het
Padi6 T A 4: 140,468,869 (GRCm39) K5* probably null Het
Pcdha5 T A 18: 37,094,615 (GRCm39) S375T probably benign Het
Pde10a C T 17: 9,159,994 (GRCm39) P140S probably benign Het
Pgbd1 C G 13: 21,607,300 (GRCm39) C298S possibly damaging Het
Plch2 C T 4: 155,071,448 (GRCm39) G977D probably benign Het
Pou2f3 T C 9: 43,040,188 (GRCm39) T367A probably damaging Het
Ppm1j T A 3: 104,692,276 (GRCm39) Y352N probably damaging Het
Prkag2 T C 5: 25,226,967 (GRCm39) T97A probably benign Het
Rpl36a-ps1 T A 14: 99,231,660 (GRCm39) Y26F probably benign Het
Sctr A T 1: 119,991,001 (GRCm39) N445Y possibly damaging Het
Serping1 C T 2: 84,603,835 (GRCm39) V69I probably benign Het
Slc8a2 T A 7: 15,878,963 (GRCm39) L483Q probably benign Het
Spag17 T C 3: 99,846,586 (GRCm39) F37L probably benign Het
Srrm2 T A 17: 24,039,290 (GRCm39) M1978K probably damaging Het
Tcp11 T C 17: 28,285,995 (GRCm39) Q540R probably benign Het
Thnsl1 G T 2: 21,217,141 (GRCm39) R298S possibly damaging Het
Tigd5 T A 15: 75,782,230 (GRCm39) Y197* probably null Het
Tmprss11g A T 5: 86,640,059 (GRCm39) L203Q probably damaging Het
Trim35 T A 14: 66,546,271 (GRCm39) V346E probably damaging Het
Ttn T C 2: 76,598,708 (GRCm39) I19402V possibly damaging Het
Ttn C T 2: 76,749,689 (GRCm39) E3787K probably benign Het
Tut1 G A 19: 8,942,778 (GRCm39) V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 (GRCm39) I18V probably benign Het
Zbbx T C 3: 75,046,853 (GRCm39) N22S possibly damaging Het
Zfp169 A C 13: 48,652,339 (GRCm39) M26R probably benign Het
Zfp180 T A 7: 23,804,686 (GRCm39) H368Q probably damaging Het
Zfp638 T A 6: 83,930,108 (GRCm39) S770T possibly damaging Het
Znrf1 T C 8: 112,263,774 (GRCm39) M1T probably null Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm39) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm39) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm39) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm39) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm39) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm39) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm39) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm39) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm39) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm39) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm39) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm39) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm39) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm39) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm39) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm39) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm39) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm39) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm39) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm39) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm39) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm39) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm39) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm39) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm39) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm39) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm39) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm39) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm39) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm39) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm39) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm39) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm39) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm39) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm39) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm39) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm39) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm39) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm39) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm39) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm39) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm39) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm39) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm39) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm39) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm39) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm39) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm39) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm39) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm39) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm39) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm39) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm39) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm39) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm39) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm39) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm39) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm39) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm39) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm39) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm39) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm39) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm39) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm39) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm39) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm39) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm39) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm39) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm39) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm39) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm39) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm39) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm39) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm39) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm39) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm39) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm39) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm39) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm39) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm39) missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7,162,802 (GRCm39) missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm39) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm39) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm39) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm39) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm39) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm39) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm39) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm39) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm39) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm39) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm39) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm39) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm39) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm39) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm39) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm39) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm39) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm39) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm39) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm39) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm39) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm39) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm39) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm39) missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7,085,009 (GRCm39) nonsense probably null
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm39) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm39) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm39) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm39) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm39) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm39) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm39) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm39) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm39) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm39) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm39) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm39) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm39) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm39) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm39) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm39) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm39) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm39) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm39) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm39) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm39) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm39) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm39) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm39) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm39) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm39) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm39) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm39) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm39) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm39) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm39) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm39) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm39) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm39) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm39) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm39) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm39) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm39) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm39) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm39) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm39) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm39) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm39) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm39) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm39) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm39) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm39) missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7,041,718 (GRCm39) missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm39) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm39) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm39) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm39) missense probably null 0.00
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm39) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm39) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm39) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm39) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm39) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm39) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm39) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm39) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm39) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm39) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm39) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm39) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm39) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm39) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm39) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm39) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm39) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm39) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm39) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm39) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm39) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm39) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm39) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm39) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm39) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm39) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm39) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm39) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm39) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm39) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm39) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm39) missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7,001,473 (GRCm39) missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm39) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm39) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm39) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm39) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm39) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm39) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm39) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm39) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm39) missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7,075,824 (GRCm39) missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm39) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm39) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm39) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm39) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm39) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm39) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm39) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm39) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm39) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm39) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm39) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm39) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm39) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm39) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm39) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm39) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm39) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm39) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm39) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm39) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm39) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm39) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm39) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm39) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm39) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm39) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm39) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm39) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAGCCAACAGACCTGG -3'
(R):5'- TCTACTGTTGGAGAATAGACACTGAG -3'

Sequencing Primer
(F):5'- TGAAGCCAACAGACCTGGAAACTAC -3'
(R):5'- TAGACACTGAGGGATCTAATTGAC -3'
Posted On 2019-05-15