Incidental Mutation 'R7084:Fbxw22'
ID549767
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7084 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109404223 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably damaging
Transcript: ENSMUST00000080626
AA Change: L14P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: L14P

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000197213
AA Change: L14P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mast3 T C 8: 70,779,473 I1287V probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mme T C 3: 63,328,217 Y195H probably damaging Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Myo1e A G 9: 70,337,801 I394V probably damaging Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Otog T A 7: 46,298,566 C145* probably null Het
Padi6 T A 4: 140,741,558 K5* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109382219 missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109382142 missense probably damaging 1.00
R4329:Fbxw22 UTSW 9 109384043 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109386761 missense probably benign
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R6949:Fbxw22 UTSW 9 109382076 missense probably benign 0.06
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
R8499:Fbxw22 UTSW 9 109385000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTCAGAGCTGAGTAGACAG -3'
(R):5'- TGCAGCTTGCTCCAGTCAAATC -3'

Sequencing Primer
(F):5'- CAGGTCTGAATAAGGTAAGTTTAAGG -3'
(R):5'- CCAGTCAAATCCTGATGAGCTGTG -3'
Posted On2019-05-15