Mutagenetix > Incidental Mutations

Incidental Mutation 'R7085:Prex2'

549796

Institutional Source

Beutler Lab

Gene Symbol

Prex2

Ensembl Gene

ENSMUSG00000048960

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2

Synonyms

C030045D06Rik, 6230420N16Rik, Depdc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R7085 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10993465-11303681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11098588 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 269 (R269S)

Ref Sequence

ENSEMBL: ENSMUSP00000027056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027056]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027056
AA Change: R269S

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: R269S

Domain	Start	End	E-Value	Type
RhoGEF	19	205	8.61e-45	SMART
PH	238	355	2.43e-12	SMART
DEP	383	456	4.46e-26	SMART
DEP	484	557	6.57e-15	SMART
PDZ	593	666	9.62e-2	SMART
PDZ	677	744	6.37e-8	SMART
low complexity region	1112	1127	N/A	INTRINSIC
low complexity region	1498	1507	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (75/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	G	1: 26,683,465	L878P	possibly damaging	Het
9330159F19Rik	T	C	10: 29,224,480	L283P	probably damaging	Het
Abhd18	T	C	3: 40,916,909	M132T	possibly damaging	Het
Afap1l1	A	G	18: 61,748,814	V270A	possibly damaging	Het
Ankrd34a	A	T	3: 96,598,629	Q383L	probably benign	Het
Atp8b5	A	G	4: 43,361,835	D627G	probably damaging	Het
Atrnl1	T	A	19: 57,691,857	C730S	probably damaging	Het
Bclaf1	T	C	10: 20,322,022	S4P	unknown	Het
Blzf1	T	C	1: 164,302,324	D153G	probably damaging	Het
Btaf1	T	C	19: 36,972,918	V516A	probably benign	Het
C1qa	T	C	4: 136,897,780	T20A	probably benign	Het
Cacna1e	A	T	1: 154,473,746		probably null	Het
Cfd	T	G	10: 79,892,492	V229G	probably damaging	Het
Chd3	T	A	11: 69,369,201	H64L	unknown	Het
Cntn3	A	G	6: 102,165,401	S1002P	possibly damaging	Het
Cntrl	T	A	2: 35,165,792	C1786S	probably benign	Het
Cpa1	A	G	6: 30,643,620	D355G	probably benign	Het
D130043K22Rik	T	C	13: 24,872,302	V539A	possibly damaging	Het
Ddx1	A	C	12: 13,229,355	W428G	probably damaging	Het
Ddx49	G	A	8: 70,302,483		probably benign	Het
Dnhd1	T	A	7: 105,715,261	V4207E	probably benign	Het
Dock3	A	G	9: 106,901,887	S288P	probably damaging	Het
Drap1	G	A	19: 5,424,787		probably benign	Het
Ecm2	G	A	13: 49,520,902	R266K	probably damaging	Het
Emilin2	A	G	17: 71,274,105	L542S	probably damaging	Het
Evx1	T	C	6: 52,316,692	Y282H	possibly damaging	Het
Fam159b	G	T	13: 104,858,306	T111K	probably benign	Het
Fbxo44	T	A	4: 148,158,743	H20L	probably damaging	Het
Flot2	G	T	11: 78,058,074	A292S	possibly damaging	Het
Fry	A	G	5: 150,438,749	I2161V	probably benign	Het
Gli3	T	C	13: 15,715,062	F587S	probably damaging	Het
Gm10697	T	A	3: 94,072,632	M5L	probably benign	Het
Gm4450	T	C	3: 98,450,394	N101D	probably damaging	Het
Gm49368	A	G	7: 128,126,857	D1147G	unknown	Het
Gm6970	A	G	19: 47,170,662	V158A	unknown	Het
Gprc5b	A	T	7: 118,983,632	M338K	probably damaging	Het
Hacd3	A	C	9: 64,998,243	N204K	probably damaging	Het
Hydin	A	G	8: 110,603,330	T4899A	probably benign	Het
Ido2	T	A	8: 24,558,196	R49S	probably benign	Het
Igsf3	C	A	3: 101,455,489	T942K	probably benign	Het
Kank4	T	A	4: 98,779,946	Q88L	probably benign	Het
Krtap16-1	T	A	11: 99,986,285	I98F	possibly damaging	Het
Laptm4a	T	C	12: 8,922,113	V52A	probably benign	Het
Lmbr1	A	T	5: 29,361,092		probably null	Het
Lnx1	G	A	5: 74,628,185	S31F	possibly damaging	Het
Mafa	G	T	15: 75,747,687	A79E	unknown	Het
Me2	A	T	18: 73,781,058	N467K	probably damaging	Het
Med23	T	A	10: 24,870,121	L8Q	probably damaging	Het
Muc16	T	A	9: 18,644,849	I3383F	unknown	Het
Nbas	G	T	12: 13,285,258	S151I	probably damaging	Het
Olfr1130	T	A	2: 87,607,406	I6N	probably benign	Het
Olfr231	T	A	1: 174,117,660	I119F	probably damaging	Het
Olfr272	C	T	4: 52,910,961	A278T	probably benign	Het
Olfr867	G	A	9: 20,054,936	H58Y	probably benign	Het
Olfr976	C	A	9: 39,956,512	C141F	probably damaging	Het
Piezo1	A	G	8: 122,490,894	V1305A		Het
Plcb3	T	C	19: 6,960,133	E639G	possibly damaging	Het
Polr2a	A	G	11: 69,743,880	L658P	probably damaging	Het
Prag1	A	T	8: 36,104,237	Q658L	possibly damaging	Het
Reln	C	A	5: 21,915,087	G2856*	probably null	Het
Rsph10b	A	T	5: 143,949,284	T267S	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,224	I161V	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Sbno1	G	A	5: 124,381,720	P1165L	possibly damaging	Het
Scn3b	T	C	9: 40,277,098	V29A	probably damaging	Het
Sh3d21	T	A	4: 126,163,091	T13S	probably benign	Het
Slc22a22	G	A	15: 57,249,649	T398I	probably benign	Het
Slc40a1	T	A	1: 45,911,528	T255S	probably benign	Het
Smchd1	A	T	17: 71,365,219		probably null	Het
Soat1	A	T	1: 156,432,331	V480D	probably damaging	Het
Supt5	T	A	7: 28,331,489	E39V	unknown	Het
Tapbpl	T	C	6: 125,226,488		probably null	Het
Tlr11	A	T	14: 50,362,656	I700F	probably damaging	Het
Tmc3	A	T	7: 83,622,145	K864M	possibly damaging	Het
Tns1	G	A	1: 73,925,462	P81S	probably benign	Het
Tspan2	C	A	3: 102,760,954	L168I	probably benign	Het
Unc13d	C	A	11: 116,064,807	S885I	probably benign	Het
Unc45a	A	T	7: 80,326,334	M799K	possibly damaging	Het
Usp34	A	G	11: 23,363,097	D547G		Het
Vps33b	A	G	7: 80,276,089	I95V	probably benign	Het

Other mutations in Prex2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Prex2	APN	1	11186652	missense	possibly damaging	0.51
IGL00948:Prex2	APN	1	11170614	missense	probably damaging	0.98
IGL01087:Prex2	APN	1	11068104	missense	probably benign	0.00
IGL01490:Prex2	APN	1	11184545	splice site	probably null
IGL01533:Prex2	APN	1	11186741	nonsense	probably null
IGL01661:Prex2	APN	1	11208614	missense	probably benign	0.01
IGL01668:Prex2	APN	1	11153645	missense	probably benign	0.00
IGL01674:Prex2	APN	1	11170741	missense	probably damaging	1.00
IGL01716:Prex2	APN	1	11266054	missense	probably benign	0.04
IGL01867:Prex2	APN	1	11098503	missense	probably benign	0.11
IGL01954:Prex2	APN	1	11140011	missense	possibly damaging	0.75
IGL01990:Prex2	APN	1	11123233	splice site	probably benign
IGL02022:Prex2	APN	1	11297739	missense	probably benign	0.04
IGL02130:Prex2	APN	1	11112799	missense	probably damaging	1.00
IGL02130:Prex2	APN	1	11160162	missense	probably damaging	1.00
IGL02221:Prex2	APN	1	11061345	missense	probably benign	0.00
IGL02369:Prex2	APN	1	11101169	critical splice donor site	probably null
IGL02440:Prex2	APN	1	11153657	missense	possibly damaging	0.94
IGL02477:Prex2	APN	1	11204154	missense	probably benign
IGL02492:Prex2	APN	1	11123845	missense	possibly damaging	0.93
IGL03051:Prex2	APN	1	11142665	missense	probably damaging	1.00
IGL03154:Prex2	APN	1	11153633	missense	possibly damaging	0.63
IGL03158:Prex2	APN	1	11266067	missense	possibly damaging	0.89
IGL03308:Prex2	APN	1	11185175	missense	possibly damaging	0.89
IGL03338:Prex2	APN	1	11140265	missense	probably benign	0.01
R0042:Prex2	UTSW	1	11080081	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0138:Prex2	UTSW	1	11285043	splice site	probably benign
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0208:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0325:Prex2	UTSW	1	11200057	splice site	probably null
R0326:Prex2	UTSW	1	11285065	missense	probably damaging	1.00
R0390:Prex2	UTSW	1	11089706	splice site	probably null
R0492:Prex2	UTSW	1	11186633	splice site	probably benign
R0512:Prex2	UTSW	1	11199933	missense	probably benign
R0515:Prex2	UTSW	1	11199874	missense	probably damaging	0.99
R0894:Prex2	UTSW	1	11181898	missense	probably benign
R1259:Prex2	UTSW	1	11289270	missense	probably damaging	1.00
R1332:Prex2	UTSW	1	11204091	missense	probably damaging	1.00
R1356:Prex2	UTSW	1	11080092	nonsense	probably null
R1451:Prex2	UTSW	1	11156259	missense	probably benign	0.01
R1488:Prex2	UTSW	1	11193528	missense	probably benign	0.05
R1512:Prex2	UTSW	1	11061330	missense	possibly damaging	0.64
R1641:Prex2	UTSW	1	11231772	missense	probably damaging	0.99
R1667:Prex2	UTSW	1	11186757	missense	probably benign
R1678:Prex2	UTSW	1	11285089	missense	possibly damaging	0.51
R1736:Prex2	UTSW	1	11089884	splice site	probably benign
R1781:Prex2	UTSW	1	11199955	missense	probably benign	0.17
R1804:Prex2	UTSW	1	11132342	missense	probably damaging	1.00
R1836:Prex2	UTSW	1	11136780	missense	probably damaging	1.00
R1899:Prex2	UTSW	1	11162366	nonsense	probably null
R1900:Prex2	UTSW	1	11162366	nonsense	probably null
R2020:Prex2	UTSW	1	11162312	missense	probably damaging	0.98
R2114:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2117:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2436:Prex2	UTSW	1	11266152	missense	possibly damaging	0.90
R2902:Prex2	UTSW	1	11208614	missense	possibly damaging	0.77
R2915:Prex2	UTSW	1	11169853	missense	probably damaging	1.00
R2924:Prex2	UTSW	1	11098487	missense	probably damaging	1.00
R2981:Prex2	UTSW	1	11181962	missense	probably damaging	1.00
R3430:Prex2	UTSW	1	11149854	missense	possibly damaging	0.88
R3832:Prex2	UTSW	1	11156364	splice site	probably benign
R3870:Prex2	UTSW	1	11160192	missense	possibly damaging	0.86
R3963:Prex2	UTSW	1	11110357	missense	possibly damaging	0.93
R4012:Prex2	UTSW	1	11184516	missense	probably benign
R4030:Prex2	UTSW	1	11208568	missense	probably benign	0.06
R4214:Prex2	UTSW	1	11101159	missense	probably damaging	1.00
R4214:Prex2	UTSW	1	11285061	missense	probably damaging	1.00
R4242:Prex2	UTSW	1	11156304	missense	probably benign	0.06
R4490:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4491:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4492:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4561:Prex2	UTSW	1	11184545	splice site	probably null
R4624:Prex2	UTSW	1	11289265	nonsense	probably null
R4647:Prex2	UTSW	1	11162285	missense	probably damaging	1.00
R4657:Prex2	UTSW	1	11065825	missense	probably benign	0.00
R4706:Prex2	UTSW	1	11199988	missense	probably damaging	1.00
R4806:Prex2	UTSW	1	11068020	missense	probably damaging	1.00
R4900:Prex2	UTSW	1	11149905	splice site	probably benign
R4922:Prex2	UTSW	1	11169940	missense	probably damaging	1.00
R4961:Prex2	UTSW	1	11098481	missense	possibly damaging	0.75
R5284:Prex2	UTSW	1	11266090	nonsense	probably null
R5305:Prex2	UTSW	1	11107678	missense	probably damaging	1.00
R5307:Prex2	UTSW	1	11200032	missense	probably damaging	0.99
R5331:Prex2	UTSW	1	11140011	missense	possibly damaging	0.75
R5385:Prex2	UTSW	1	11139980	missense	probably damaging	0.99
R5574:Prex2	UTSW	1	11140058	missense	probably damaging	1.00
R5979:Prex2	UTSW	1	11132372	missense	probably damaging	1.00
R6076:Prex2	UTSW	1	11185950	missense	probably benign	0.09
R6160:Prex2	UTSW	1	10993851	missense	probably damaging	1.00
R6177:Prex2	UTSW	1	11136777	missense	possibly damaging	0.49
R6221:Prex2	UTSW	1	11266012	missense	probably benign	0.01
R6293:Prex2	UTSW	1	11162298	missense	probably benign
R6335:Prex2	UTSW	1	11110320	missense	probably benign	0.13
R6401:Prex2	UTSW	1	11186727	missense	probably benign	0.00
R6427:Prex2	UTSW	1	11182031	missense	probably damaging	1.00
R6467:Prex2	UTSW	1	11266035	missense	probably damaging	1.00
R6564:Prex2	UTSW	1	11101061	splice site	probably null
R6734:Prex2	UTSW	1	11080059	missense	probably damaging	1.00
R6753:Prex2	UTSW	1	11184456	missense	probably damaging	0.98
R6880:Prex2	UTSW	1	11132384	missense	probably damaging	1.00
R6973:Prex2	UTSW	1	11112743	missense	probably damaging	1.00
R6980:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R6987:Prex2	UTSW	1	11170752	missense	probably damaging	0.99
R7101:Prex2	UTSW	1	11153609	missense	possibly damaging	0.86
R7106:Prex2	UTSW	1	11136793	missense	probably benign	0.33
R7319:Prex2	UTSW	1	11162308	missense	probably benign	0.10
R7342:Prex2	UTSW	1	11162325	missense	probably benign	0.00
R7469:Prex2	UTSW	1	11285069	missense	probably damaging	1.00
R7528:Prex2	UTSW	1	11204092	missense	probably damaging	1.00
R7592:Prex2	UTSW	1	11123213	missense	probably damaging	1.00
R7650:Prex2	UTSW	1	11149854	missense	possibly damaging	0.67
R7695:Prex2	UTSW	1	11162273	missense	probably benign	0.00
R7720:Prex2	UTSW	1	11181937	missense	possibly damaging	0.47
R7733:Prex2	UTSW	1	11181959	missense	probably benign	0.31
R7859:Prex2	UTSW	1	11080050	missense	probably damaging	1.00
R8247:Prex2	UTSW	1	11199970	missense	probably benign
R8300:Prex2	UTSW	1	11231718	missense	possibly damaging	0.49
R8345:Prex2	UTSW	1	11199894	missense	possibly damaging	0.65
R8352:Prex2	UTSW	1	11285139	missense	probably benign
R8352:Prex2	UTSW	1	11285140	missense	probably benign
R8410:Prex2	UTSW	1	11153657	missense	possibly damaging	0.94
R8452:Prex2	UTSW	1	11285139	missense	probably benign
R8452:Prex2	UTSW	1	11285140	missense	probably benign
RF005:Prex2	UTSW	1	11185166	missense	possibly damaging	0.47
Z1177:Prex2	UTSW	1	11289252	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGACACCCTTCATTTGATCCCAG -3'
(R):5'- TCCCCTTGAAAGAGCTGTTG -3'

Sequencing Primer
(F):5'- CTTCATTTGATCCCAGCACTATAAAG -3'
(R):5'- GCTGTTGGGGGAAAGTCAC -3'

Posted On

2019-05-15