Incidental Mutation 'R7085:4931408C20Rik'
ID549797
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7085 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26683465 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 878 (L878P)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097801
AA Change: L878P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: L878P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (75/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cacna1e A T 1: 154,473,746 probably null Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cntrl T A 2: 35,165,792 C1786S probably benign Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Flot2 G T 11: 78,058,074 A292S possibly damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lmbr1 A T 5: 29,361,092 probably null Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Muc16 T A 9: 18,644,849 I3383F unknown Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prag1 A T 8: 36,104,237 Q658L possibly damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Smchd1 A T 17: 71,365,219 probably null Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tapbpl T C 6: 125,226,488 probably null Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tns1 G A 1: 73,925,462 P81S probably benign Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
R7726:4931408C20Rik UTSW 1 26684498 missense probably benign 0.08
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTCAGAAGTGTAGGTGGAGTCAC -3'
(R):5'- AGGCTTGGGAGAGTAAGTCC -3'

Sequencing Primer
(F):5'- GTGGAGTCACCCATTTGAAATGCC -3'
(R):5'- GAGAGTAAGTCCTTCTATCCCGAG -3'
Posted On2019-05-15