Incidental Mutation 'R0614:Plxnb3'
ID54983
Institutional Source Beutler Lab
Gene Symbol Plxnb3
Ensembl Gene ENSMUSG00000031385
Gene Nameplexin B3
SynonymsPlxn6
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location73757090-73772514 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 73764358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002079]
Predicted Effect probably benign
Transcript: ENSMUST00000002079
SMART Domains Protein: ENSMUSP00000002079
Gene: ENSMUSG00000031385

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Sema 44 445 5.53e-102 SMART
PSI 463 515 8.91e-10 SMART
Blast:Sema 533 592 2e-9 BLAST
PSI 609 671 8.95e-1 SMART
PSI 776 822 5e-1 SMART
IPT 823 914 7.15e-15 SMART
IPT 915 1001 5.63e-13 SMART
IPT 1003 1134 7.17e-1 SMART
Pfam:TIG 1148 1232 7.7e-7 PFAM
low complexity region 1246 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1317 1869 2.7e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155096
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the plexin family. It functions as a receptor for semaphorin 5A, and plays a role in axon guidance, invasive growth and cell migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal retinal stratification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Plxnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Plxnb3 APN X 73765283 missense probably benign 0.04
R2062:Plxnb3 UTSW X 73771751 nonsense probably null
R2063:Plxnb3 UTSW X 73771751 nonsense probably null
R2064:Plxnb3 UTSW X 73771751 nonsense probably null
R2065:Plxnb3 UTSW X 73771751 nonsense probably null
R2066:Plxnb3 UTSW X 73771751 nonsense probably null
R2068:Plxnb3 UTSW X 73771751 nonsense probably null
R3955:Plxnb3 UTSW X 73771220 missense probably benign 0.02
R3957:Plxnb3 UTSW X 73771220 missense probably benign 0.02
X0025:Plxnb3 UTSW X 73759332 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAGTCCCGACCAAGGTGACAAAG -3'
(R):5'- TCACCGAGCAGAGATGCGGTAG -3'

Sequencing Primer
(F):5'- TGTGGAACAGCTATGCCCTATAC -3'
(R):5'- TGCGGTAGAGAGAAGGGTC -3'
Posted On2013-07-11