Incidental Mutation 'R7085:Muc16'
ID549837
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7085 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18644849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 3383 (I3383F)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: I3383F
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (75/79)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,683,465 L878P possibly damaging Het
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cacna1e A T 1: 154,473,746 probably null Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cntrl T A 2: 35,165,792 C1786S probably benign Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Flot2 G T 11: 78,058,074 A292S possibly damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lmbr1 A T 5: 29,361,092 probably null Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prag1 A T 8: 36,104,237 Q658L possibly damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Smchd1 A T 17: 71,365,219 probably null Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tapbpl T C 6: 125,226,488 probably null Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tns1 G A 1: 73,925,462 P81S probably benign Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGCAGAGTTGAAGTCATTTC -3'
(R):5'- GGCTATGTCTACACTGCCTG -3'

Sequencing Primer
(F):5'- CTGTGCCCAAGTCATTGAATATCG -3'
(R):5'- CTGTCTCAGGAGCTTTAACAGAAAAC -3'
Posted On2019-05-15