Incidental Mutation 'R7085:Flot2'
ID549851
Institutional Source Beutler Lab
Gene Symbol Flot2
Ensembl Gene ENSMUSG00000061981
Gene Nameflotillin 2
SynonymsEsa, reggie-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7085 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78037931-78060434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78058074 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 292 (A292S)
Ref Sequence ENSEMBL: ENSMUSP00000072136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000100784] [ENSMUST00000148162]
PDB Structure
Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072289
AA Change: A292S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981
AA Change: A292S

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073660
AA Change: A292S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981
AA Change: A292S

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100784
AA Change: A243S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981
AA Change: A243S

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced metastase into the lungs in a breast cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,683,465 L878P possibly damaging Het
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cacna1e A T 1: 154,473,746 probably null Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cntrl T A 2: 35,165,792 C1786S probably benign Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lmbr1 A T 5: 29,361,092 probably null Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Muc16 T A 9: 18,644,849 I3383F unknown Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prag1 A T 8: 36,104,237 Q658L possibly damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Smchd1 A T 17: 71,365,219 probably null Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tapbpl T C 6: 125,226,488 probably null Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tns1 G A 1: 73,925,462 P81S probably benign Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in Flot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Flot2 APN 11 78049507 missense probably damaging 1.00
IGL02965:Flot2 APN 11 78059205 missense possibly damaging 0.50
PIT4382001:Flot2 UTSW 11 78053367 missense possibly damaging 0.85
R0330:Flot2 UTSW 11 78058958 missense possibly damaging 0.94
R1200:Flot2 UTSW 11 78054805 missense probably damaging 1.00
R1700:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1701:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1735:Flot2 UTSW 11 78058005 missense probably benign 0.05
R1992:Flot2 UTSW 11 78058619 missense probably damaging 0.97
R4812:Flot2 UTSW 11 78053365 missense probably damaging 0.99
R4840:Flot2 UTSW 11 78057513 missense probably damaging 1.00
R4927:Flot2 UTSW 11 78059062 missense probably damaging 0.98
R5396:Flot2 UTSW 11 78049488 nonsense probably null
R6865:Flot2 UTSW 11 78049492 missense probably benign 0.05
R7262:Flot2 UTSW 11 78057349 missense probably damaging 0.99
R7286:Flot2 UTSW 11 78054786 missense probably benign 0.05
R7350:Flot2 UTSW 11 78057976 missense probably damaging 1.00
R7359:Flot2 UTSW 11 78058557 missense probably benign 0.25
R7498:Flot2 UTSW 11 78053362 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATCCTCCTGCTCCAGACAG -3'
(R):5'- GGAACCCTGGACTCTTAACTTATTG -3'

Sequencing Primer
(F):5'- TCCTGCTCCAGACAGCTGAG -3'
(R):5'- CCAGACAACATGCCTGGG -3'
Posted On2019-05-15