Incidental Mutation 'R7086:Olfr1263'
ID549879
Institutional Source Beutler Lab
Gene Symbol Olfr1263
Ensembl Gene ENSMUSG00000059112
Gene Nameolfactory receptor 1263
SynonymsMOR234-2, GA_x6K02T2Q125-51447049-51447969
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90012131-90018424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90015250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 107 (I107V)
Ref Sequence ENSEMBL: ENSMUSP00000149887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably benign
Transcript: ENSMUST00000111507
AA Change: I107V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: I107V

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 7.6e-42 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.7e-5 PFAM
Pfam:7tm_1 36 282 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
AA Change: I107V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216616
Predicted Effect probably benign
Transcript: ENSMUST00000217065
AA Change: I107V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Olfr1263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr1263 APN 2 90015719 missense probably damaging 1.00
IGL01512:Olfr1263 APN 2 90015292 missense probably damaging 1.00
IGL01722:Olfr1263 APN 2 90015007 missense probably benign 0.39
IGL01787:Olfr1263 APN 2 90015311 missense probably damaging 1.00
IGL02376:Olfr1263 APN 2 90015460 missense probably benign 0.00
IGL03408:Olfr1263 APN 2 90015571 missense probably benign 0.35
R0367:Olfr1263 UTSW 2 90015772 missense probably damaging 0.99
R0765:Olfr1263 UTSW 2 90015670 missense probably benign 0.01
R1158:Olfr1263 UTSW 2 90015254 missense possibly damaging 0.94
R1705:Olfr1263 UTSW 2 90015511 missense possibly damaging 0.90
R1794:Olfr1263 UTSW 2 90015020 missense probably damaging 1.00
R2197:Olfr1263 UTSW 2 90015424 missense probably damaging 1.00
R2347:Olfr1263 UTSW 2 90015614 missense possibly damaging 0.82
R2442:Olfr1263 UTSW 2 90015341 missense probably benign
R3160:Olfr1263 UTSW 2 90015021 nonsense probably null
R3162:Olfr1263 UTSW 2 90015021 nonsense probably null
R4298:Olfr1263 UTSW 2 90015649 missense probably benign 0.13
R4898:Olfr1263 UTSW 2 90015418 missense probably damaging 1.00
R5340:Olfr1263 UTSW 2 90015362 missense probably benign
R6280:Olfr1263 UTSW 2 90015049 missense possibly damaging 0.62
R6367:Olfr1263 UTSW 2 90015016 missense probably benign 0.00
R6556:Olfr1263 UTSW 2 90015094 missense probably damaging 1.00
R7502:Olfr1263 UTSW 2 90015011 missense probably benign 0.15
R7585:Olfr1263 UTSW 2 90015049 missense probably damaging 0.99
R8062:Olfr1263 UTSW 2 90015736 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACCATTTTCATCAGCCCAG -3'
(R):5'- CAGAGTGTGAGTGTCAGTGC -3'

Sequencing Primer
(F):5'- TCATCAGCCCAGCCCTG -3'
(R):5'- GCCAACTCCAGGAGTGGTATTAAATC -3'
Posted On2019-05-15