Mutagenetix > Incidental Mutation

Incidental Mutation 'R0615:Atp1a4'

54988

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

038804-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 172232060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably benign
Transcript: ENSMUST00000111243

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	C	A	11: 29,824,515	R314L	probably damaging	Het
4933411K16Rik	T	C	19: 42,052,523	I31T	possibly damaging	Het
Abca13	A	G	11: 9,256,197	I166V	probably damaging	Het
Acaa2	G	T	18: 74,798,446	V238L	probably benign	Het
Ahsg	A	T	16: 22,899,055	I296F	possibly damaging	Het
Aspm	T	A	1: 139,487,289	V1436D	probably damaging	Het
Ate1	A	T	7: 130,513,833		probably benign	Het
Aurkc	A	T	7: 7,002,403	I223L	possibly damaging	Het
Bckdha	G	T	7: 25,641,785	D50E	probably benign	Het
Brf2	C	T	8: 27,124,031	E376K	probably benign	Het
Cdk9	C	A	2: 32,709,801	L141F	possibly damaging	Het
Cgn	A	C	3: 94,770,714		probably benign	Het
Clcn1	G	A	6: 42,305,575	V526I	probably damaging	Het
Cnot2	A	G	10: 116,498,236	V343A	possibly damaging	Het
Commd2	A	T	3: 57,646,695	V195D	possibly damaging	Het
Cubn	C	T	2: 13,360,252		probably null	Het
Eif2ak4	C	T	2: 118,436,185	T729M	probably damaging	Het
Elac1	A	T	18: 73,738,883	V347E	probably damaging	Het
Fam209	T	C	2: 172,474,133	S143P	probably benign	Het
Fam20c	G	A	5: 138,807,486	R454Q	probably damaging	Het
Fam214a	T	A	9: 75,004,288	Y14N	probably damaging	Het
Faxc	C	T	4: 21,958,608	S255L	probably benign	Het
Foxj1	T	C	11: 116,334,082	D153G	possibly damaging	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Lmo7	T	A	14: 101,876,859	Y12*	probably null	Het
Matn3	T	G	12: 8,963,594	C425W	probably damaging	Het
Mmd2	A	T	5: 142,564,913	M190K	probably benign	Het
Morn2	A	T	17: 80,295,597	T102S	probably damaging	Het
Nr3c2	A	C	8: 77,185,889	T710P	probably benign	Het
Nrros	C	A	16: 32,144,085	L343F	probably damaging	Het
Ntrk2	C	T	13: 59,128,186	Q767*	probably null	Het
Olfr1297	C	T	2: 111,621,919	D52N	possibly damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Plekhf2	C	T	4: 10,991,330	R4H	probably benign	Het
Ppox	A	G	1: 171,277,814		probably benign	Het
Qprt	T	A	7: 127,109,076	D61V	probably damaging	Het
Reln	A	G	5: 22,010,150	V1101A	probably benign	Het
Sbno1	T	C	5: 124,410,139	N124D	probably damaging	Het
Scx	C	T	15: 76,458,095	P165L	probably benign	Het
Sema6d	T	C	2: 124,654,135		probably benign	Het
Serf2	T	C	2: 121,450,855	F92L	probably benign	Het
Synpo2	A	T	3: 123,117,287	N236K	probably damaging	Het
Tbc1d32	C	A	10: 56,224,640	D81Y	probably benign	Het
Terf2	G	A	8: 107,082,990	T232I	possibly damaging	Het
Tpd52l2	A	G	2: 181,501,951	E50G	probably damaging	Het
Tprn	A	G	2: 25,264,198	E504G	probably damaging	Het
Tufm	G	T	7: 126,487,482	R12L	probably benign	Het
Vmn2r8	A	G	5: 108,799,329	F519S	probably damaging	Het
Vwa8	T	C	14: 78,908,150	V89A	probably benign	Het
Wnt3	T	C	11: 103,812,381	I230T	possibly damaging	Het
Zan	A	T	5: 137,468,431	F388Y	probably damaging	Het
Zfp474	C	T	18: 52,638,349	L25F	probably benign	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CTTCACATATGGGAAGGGGCACTG -3'
(R):5'- GGGCACCATAACCATTCTCTGCATC -3'

Sequencing Primer
(F):5'- CCCTGACTTCTAAACAGAGGTG -3'
(R):5'- ATCGACCTGGGCACTGAC -3'

Posted On

2013-07-11