Incidental Mutation 'R7086:Plcb4'
ID549880
Institutional Source Beutler Lab
Gene Symbol Plcb4
Ensembl Gene ENSMUSG00000039943
Gene Namephospholipase C, beta 4
SynonymsA930039J07Rik, C230058B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location135659011-136014593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136007847 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1133 (M1133V)
Ref Sequence ENSEMBL: ENSMUSP00000105736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000147744] [ENSMUST00000184371]
Predicted Effect probably benign
Transcript: ENSMUST00000035646
AA Change: M1133V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: M1133V

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 1.1e-26 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110109
AA Change: M1133V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: M1133V

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 6.1e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 913 955 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147744
AA Change: M194V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117578
Gene: ENSMUSG00000039943
AA Change: M194V

DomainStartEndE-ValueType
Pfam:DUF1154 1 16 1.7e-7 PFAM
coiled coil region 187 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184371
SMART Domains Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 9e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.1e-23 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Plcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Plcb4 APN 2 135971798 missense probably benign 0.26
IGL01405:Plcb4 APN 2 135950347 missense probably damaging 1.00
IGL01522:Plcb4 APN 2 136002627 missense probably damaging 1.00
IGL01589:Plcb4 APN 2 135967118 missense probably benign
IGL02090:Plcb4 APN 2 135947121 missense probably benign 0.00
IGL02247:Plcb4 APN 2 135994325 missense possibly damaging 0.95
IGL02259:Plcb4 APN 2 135910246 critical splice donor site probably null
IGL02338:Plcb4 APN 2 136000180 missense possibly damaging 0.87
IGL02625:Plcb4 APN 2 135961794 missense probably benign 0.19
IGL03026:Plcb4 APN 2 135950429 splice site probably benign
IGL03111:Plcb4 APN 2 135976282 missense probably damaging 1.00
R0044:Plcb4 UTSW 2 135971856 missense probably damaging 1.00
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0143:Plcb4 UTSW 2 135976211 missense probably damaging 1.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0348:Plcb4 UTSW 2 135968419 missense probably damaging 1.00
R0557:Plcb4 UTSW 2 135954349 missense probably damaging 0.99
R0591:Plcb4 UTSW 2 135955012 splice site probably benign
R0975:Plcb4 UTSW 2 135987912 splice site probably benign
R1187:Plcb4 UTSW 2 135968394 missense probably benign 0.36
R1235:Plcb4 UTSW 2 135972948 missense probably damaging 1.00
R1445:Plcb4 UTSW 2 136000189 missense possibly damaging 0.90
R1562:Plcb4 UTSW 2 135970447 critical splice donor site probably null
R1594:Plcb4 UTSW 2 135970390 splice site probably benign
R1920:Plcb4 UTSW 2 136013027 missense probably damaging 1.00
R2041:Plcb4 UTSW 2 135938271 missense probably damaging 1.00
R2141:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2142:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2202:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2203:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2204:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2250:Plcb4 UTSW 2 135971861 critical splice donor site probably null
R2291:Plcb4 UTSW 2 135939983 missense probably benign 0.08
R2326:Plcb4 UTSW 2 135939973 missense probably damaging 0.99
R2442:Plcb4 UTSW 2 135950382 missense probably damaging 1.00
R2939:Plcb4 UTSW 2 135939203 splice site probably benign
R3774:Plcb4 UTSW 2 135958145 missense probably benign 0.00
R3875:Plcb4 UTSW 2 136002632 missense probably damaging 0.99
R4594:Plcb4 UTSW 2 136002599 missense probably damaging 0.98
R4673:Plcb4 UTSW 2 135932271 missense possibly damaging 0.68
R4812:Plcb4 UTSW 2 136007881 missense probably damaging 1.00
R5084:Plcb4 UTSW 2 136002651 missense probably damaging 1.00
R5468:Plcb4 UTSW 2 135967152 missense probably damaging 1.00
R5498:Plcb4 UTSW 2 135976172 missense probably damaging 1.00
R5923:Plcb4 UTSW 2 135961814 nonsense probably null
R6241:Plcb4 UTSW 2 135910174 missense possibly damaging 0.80
R6492:Plcb4 UTSW 2 135973071 nonsense probably null
R6514:Plcb4 UTSW 2 135954996 missense probably benign 0.22
R6570:Plcb4 UTSW 2 135982986 missense probably benign 0.13
R6721:Plcb4 UTSW 2 135910237 missense probably benign 0.01
R6915:Plcb4 UTSW 2 135947115 missense possibly damaging 0.84
R6991:Plcb4 UTSW 2 135910194 missense probably damaging 1.00
R7040:Plcb4 UTSW 2 135932262 missense probably benign
R7114:Plcb4 UTSW 2 135982123 critical splice donor site probably null
R7249:Plcb4 UTSW 2 136007821 critical splice acceptor site probably null
R7264:Plcb4 UTSW 2 135965080 missense probably benign
R7361:Plcb4 UTSW 2 135976148 missense possibly damaging 0.82
R7426:Plcb4 UTSW 2 136000219 missense probably benign 0.00
R7429:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
R7430:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCACCTTCCAGTCATG -3'
(R):5'- GACCCAGAAAGTCTCTCTACCTTC -3'

Sequencing Primer
(F):5'- CAGCCATTTTCTAAGACTTGGGAAGG -3'
(R):5'- AGAAAGTCTCTCTACCTTCCACTG -3'
Posted On2019-05-15